 Detergent compositions comprising a mannanase and a clay
专利摘要:
The present invention relates to laundry detergents and / or fabric protection compositions comprising metnanase and clay for superior fabric protection and cleaning performance. 公开号:KR20010022893A 申请号:KR1020007001497 申请日:1998-06-10 公开日:2001-03-26 发明作者:베띠올쟝-뤽필립 申请人:데이비드 엠 모이어；더 프록터 앤드 갬블 캄파니； IPC主号:
专利说明:
Detergent compositions comprising a mannanase and a clay} Field of invention The present invention relates to laundry detergents and / or textile care compositions comprising mannanases and clays. Background of the Invention The performance of detergent products is determined by a variety of factors including decontamination ability, prevention of re-deposition of contamination, or contaminant products on the product during cleaning. Thus, detergent compositions currently comprise complex combinations of active ingredients that meet certain specific needs. In particular, recent detergent formulations generally include detergent and detergent enzymes that provide cleaning and fabric protection benefits. In addition, there is a need in the art for detergent compositions that exhibit not only good detergency but also fabric softening performance and other fabric protection benefits. Softened clays are commonly used in recent laundry detergents and fabric protection compositions to provide a soft feel. EP-A 177 165 describes the use of softened clays with cellulase in detergent compositions. EP-A 495 258 describes detergent compositions comprising surfactants, extender systems, softening clays and cellulase. Food and cosmetic stains / contaminations represent the majority of consumer-related stains / contaminations and often include food additives such as thickeners / stabilizers. Indeed, hydrocollide gums and emulsifiers are commonly used food additives. The term "gum" refers to a group of industrially useful polysaccharides (long chain polymers) or derivatives thereof that hydrate in hot or cold water to form viscous solutions, dispersions or gels. Black is classified into natural and modified. Natural black seaweed extract, plant extrudates, gums from seeds or roots and gums obtained by microbial fermentation. Modified (semisynthetic) gums include cellulose and starch derivatives and certain synthetic gums such as lower methoxyl pectin, propylene glycol alginate, and carboxymethyl and hydropropyl guar gum. Gums in Encyclopedia Chemical Technology 4th Ed. 12, pp 842-862, J. Baird, Kelco division of Merck. Reference: Carbohydrate Chemistry for Food Scientists (Eagan Press-1997) by R.L. Whistler and J.N. BeMiller, Chap 4, pp63-89 and Direct Food Additives in Fruit Processing by P.Laslo, Bioprinciples and Applications, Vol 1, Chapter II, pp313-325 (1996) Technomie publishing. Some of these gums, such as guar gum (E412) and locust beans (E410), are widely used alone or in combination in various foods. Gums in ECT 4th Ed., Vol. 12 pp 842-862, J. Baird, Kelco division of Merck. Guar gum legumes used in these food and cosmetic stains are obtained from seed endosperm of Cyamopsis tetragonoloba. Guar gum (also called guaran) extracted from dicotyledonous seeds consists of 1-4, bD-mannopyranosyl unit backbones and is used as a thickening agent in dressing and frozen products and cosmetics [ Reference: H.-D. Belitz, Food Chemistry pp 243, English version of the second edition, Springer-verlag, 1987, ISBN 0-387-15043-9 (US); Carbohydrate Chemistry for Food Scientists, R.L. Wilstler, eagan press, 1997, ISBN 0-913250-92-9; Industrial Gum, second editions, R.L. Whistler pp 308, Academic Press, 1973, ISBN, 0-12-74-6252-x. Locus bean gum (also called carob bean gum or St Jon's bread) is also extracted from the seeds of evergreen trees used in the food industry and grown in the Mediterrannean region. Locus bean gum has a 1-4, b-D-mannopyranosyl backbone that is probably different from the structure of guar gum in that there are fewer D-galactosyl side chains. In legume seeds, water-soluble calactomannan is in some cases the main storage carbohydrate, accounting for less than 20% of the total dry weight. Galactomannans have α-galactose bound to O-6 of mannose residues and can also be acetylated to varying degrees for O-2 and O-3 of mannose residues. However, clays do not blend with some hydrocolloid gums contained in these food and cosmetic stains. In the art, guar gums are recognized to induce precipitation of clay due to the potential for flocculation of clay or clay particles. Industrial Gum, second editions, R.L. Whistler pp 307, Academic Press, 1973, ISBN, 0-12-74-6252-x. It is therefore an object of the present invention to provide laundry detergents and / or fabric protection compositions which exhibit optimal softening performance and in particular provide optimum stain removal and cleaning performance for cosmetic and food stains. This object is achieved by preparing laundry detergents and / or fabric protection compositions comprising metnanase enzyme and clay as emollients. It has further been found that the performance of the detergent compositions of the present invention is enhanced by adding laundry detergents and / or fabric protective ingredients selected from extenders, cellulase and / or cationic surfactants. Metases are found in some Bacillus organisms. See, eg, Talbot et al., Appl. Environ. Microbiol., Vol. 56, No. 11, pp. 3505-3510 (1990), discloses β-derived from Bacillus stearothermophilus in the form of a dimer with a MW of 162 kDa and an optimal pH of 5.5 to 7.5. Mannanases are described. See Mendoza et al., World J. Micobio. Boitech., Vol. 10, no. 5, pp. 551-555 (1994)] have a β-mannanase derived from Bacillus Subtilisis with a MW of 38 kDa, optimal activity at pH 5.0 / 55 ° C., and a pI of 4.8. Is described. J0304706 describes β-mannanases derived from Bacillus species with MW measured by gel filtration of 37 +/- 3 kDa with an optimal pH of 8 to 10 and a pi of 5.3 to 5.4. J63056289 discloses, for example, the preparation of alkaline thermostable β-mannanases that hydrolyze β-1,4-D-mannopyranoside bonds of mannan and produce manno: oligo: saccharides. Is described. J63036774 relates to Bacillus microorganism FERM P-8856, which produces β-mannanase and β-mannosidase at alkaline pH. Purified mannanases from Bacillus amyloliquefaciens, and their preparation useful for bleaching pulp and paper are described in WO 97/11164. WO 91/18974 describes hemicellases active at extreme pH and temperature, for example glucanase, xylanase or mannanase and methods for their preparation. WO 94/25576 describes enzymes exhibiting antagonist activity derived from Aspergillus aculeatus CBS 101.43, which require degradation or modification of plant or algal cell wall material. It can be used for various purposes. WO 93/24622 describes mannanases isolated from Trichoderma reesie for bleaching lignocellulosic pulp. However, synthetic formulations of mannanases and clays for optimal softening performance in laundry detergents and / or fabric protection compositions and in particular for optimal stain removal and cleaning performance for cosmetic and food stains have never been recognized. Summary of the Invention The present invention relates to laundry detergents and / or fabric protection compositions comprising metnase and clay to provide optimum softening performance and in particular to optimal stain removal and cleaning performance for cosmetic and food stains. Detailed description of the invention In the art, clay is known to be incompatible with some hydrocolloid gums contained in, for example, food and cosmetic stains. Guar gum has been recognized to induce precipitation of clay due to its potential for flocculation of clay or clay particles [Industrial Gum, second editions, R.L. Whistler pp 307, Academic Press, 1973, ISBN, 0-12-74-6252-x. Without wishing to be bound by theory, these aggregated clays have been found to reduce the softening effect. In addition, clay and contamination from wash loads have been observed to re-deposit into guar gum residues to stain. Surprisingly, the metase enzyme has been found to hydrolyze hydrocolloid gums, in particular guar gum. This enzymatic hydrolysis leads to the absence of guar gum during washing. Thus, no clay aggregates and clays have full fabric protection potential. In addition, since there is no guar gum residue remaining on the fabric, there is no redeposition and subsequent staining of clay and contamination with the following wash load. Metase enzyme An essential component of the laundry detergent and / or textile care composition of the present invention is a metase enzyme. Three mannanase degrading enzymes are included in the present invention: EC 3.2.1.25:: β-mannosidase, EC 3.2.1.78: endo-1,4-β-mannosidase (hereinafter “mannanase”) And EC 3.2.1.100: 1,4-β-mannobiosidase (IUPAC Taxonomy-Enzyme Nomenclature, 1992 ISBN 0-12-227165-3 Academic Press). More preferably, the laundry detergent and / or fabric protection composition of the present invention comprises β-1,4-mannosidase (E.C. 3.2.1.78), referred to as a metnanase. The term "mannase" or "galactomannanase" is officially referred to as met endo-1,4-beta-mannosidase and has the alternative names beta-mannase and endo-1,4-mannanase. Refers to a mannanase enzyme defined according to the art which catalyzes the random hydrolysis of 1,4-beta-D-mannodic bonds in galactomannan, glucomannan and galactoglucomannan. In particular, mannanases (EC 3.2.1.78) constitute a group of polysaccharides that break down mannans and are capable of breaking down the polysaccharide chains containing mannose units, ie mannan, glucomannan, galactomannan and galactogluco- Refers to an enzyme capable of breaking down glycosidic bonds in mannan. Mannan is a polysaccharide with a backbone consisting of β-1,4-linked mannose, glucomannan is a polysaccharide with a backbone or somewhat regular alteration of β-1,4-linked mannose and glucose, and calactomannan And galactoglucomannan are mannan and glucomannan with α-1,6-linked galactose side chains. These compounds can be acetylated. The degradation of galactomannan and galactoglucomannan is facilitated by complete or partial removal of galactose side chains. In addition, the degradation of acetylated mannan, glucomannan, galactomannan and galactoglucomannan is facilitated by complete or partial deacetylation. Acetyl groups can be removed by alkali or met acetylesterases. The oligomers released from the mannase or by the combination of the mannase with α-galactosidase and / or met acetyl esterase are further degraded and freed by β-mannosidase and / or β-glucosidase. Tods may be released. Metases are found in some Bacillus organisms. See, eg, Talbot et al., Appl. Environ. Microbiol., Vol. 56, No. 11, pp. 3505-3510 (1990) describe beta-mannanases derived from Bacillus stearotermophilus in the form of dimers having a molecular weight of 162 kDa and an optimal pH of 5.5 to 7.5. It is. See Mendoza et al., World J. Microbiol. Biotech., Vol. 10, No. 5, pp. 551-555 (1994) describe beta-mannanases derived from Bacillus Subtilis having a molecular weight of 38 kDa, optimal activity at pH 5.0 and 55 C, and a pI of 4.8. JP-0304706 describes beta-mannanases derived from Bacillus species with molecular weights of 373 kDa, optimum pH of 8 to 10 and pi of 5.3 to 5.4, as determined by gel filtration. JP 63056289 discloses, for example, alkaline thermostable beta-mannanases that hydrolyze beta-1,4-D-mannopyranoside bonds of mannan and produce manno-oligosaccharides. Manufacturing is described. Document JP 63036774 relates to Bacillus microorganism FERM P-8856, which produces beta-mannanase and beta-mannosidase at alkaline pH. Document JP 08051975 describes alkaline beta-mannanases from alkalophilic Bacillus species AM-001. Purified mannanases from Bacillus amyloliquefaciens useful for bleaching pulp and paper and methods for their preparation are described in WO 97/11164. WO 91/18974 describes hemicellulases such as glucanase, xylanase or mannanase that are active at extreme pH and temperature. WO 94/25576 describes enzymes from Aspergillus aureatus, CBS 101.43, which exhibit mannanase activity that may be useful for the degradation or modification of plant or algal cell wall material. WO 93/24622 describes mannanases isolated from Trichoderma leshi useful for bleaching lignocellulosic pulp. Hemicelluloses capable of degrading mannan-containing hemicellulose are described in WO 91/18974 and purified mannanases from Bacillus amyloliquefaciens are described in WO 97/11164. ]. In particular, such mannanase enzymes can be alkaline mannanases, as defined below, most preferably mannanases originating from bacterial sources. In particular, the laundry detergent composition of the present invention comprises an alkaline nanase selected from strain Bacillus agaradherens and / or Bacillus subtilis strain 168, nanase from gene yght. The term "alkaline mannanase enzyme" includes enzymes whose enzyme activity is at least 10%, preferably at least 25%, more preferably at least 40% of the maximum activity at a given pH in the range of 7 to 12, preferably 7.5 to 10.5. Done. Most preferably, the laundry detergent and / or textile care composition of the present invention may comprise an alkaline mannanase from Bacillus agaradherens. The metase is Iii) Bacillus agaradherens, polypeptide produced by NCIMB 40482, Ii) a polypeptide comprising an amino acid sequence as shown at positions 32 to 343 of SEQ ID NO: 2, or Iii) immunologically reactive with a polyclonal antibody that is at least 70% similar to the polypeptide, is derived from the polypeptide by substitution, deletion or addition of one or several amino acids or is raised against the polypeptide in purified form Is an analog of a polypeptide as defined in phosphorus, vi) or ii). The invention also (a) a polynucleotide molecule encoding a polypeptide having a metase activity and comprising a sequence of nucleotides as shown in SEQ ID NO: 1 from nucleotides 97 to nucleotides 1029; (b) the species homologues of (a); (c) a polynucleotide molecule encoding a polypeptide having a mannanase activity at least 70% identical to the amino acid sequence of SEQ ID NO: 2 from amino acid residue 32 to amino acid residue 343; (d) a molecule complementary to (a), (b) or (c); And (e) an isolated polypeptide having a mannanase activity selected from the group consisting of synonymous nucleotide sequences of (a), (b), (c) or (d). Plasmid pSJ1678 comprising a polynucleotide molecule (DNA sequence) encoding a metase of the present invention is under Deutsche Sammlung, De-38124 Braunschweig, Mace-derugue Weg 1be, Germany, dated May 18, 1998 under accession number DSM 12180. von Mikroorganismen und Zellkulturen GmbH was transformed into strains of Escherichia coli deposited by the inventors in accordance with the Budapest Treaty for International Approval of Microbial Deposits for the purpose of patent procedure. The second most preferred enzyme is a metase from Bacillus subtilis strain 168. Iii) encoded by a metnase from the DNA sequence shown in SEQ ID NO: 5 or a coding portion of an analog of the sequence, and / or Ii) a polypeptide comprising an amino acid sequence as shown in SEQ ID NO: 6; Iii) immunologically reactive with a polyclonal antibody that is at least 70% similar to the polypeptide, is derived from the polypeptide by substitution, deletion or addition of one or several amino acids or is raised against the polypeptide in purified form Is an analog of the polypeptide as defined in ii). The invention also (a) a polynucleotide molecule encoding a polypeptide having a metase activity and comprising a sequence of nucleotides as shown in SEQ ID NO: 5; (b) the species homologues of (a); (c) a polynucleotide molecule encoding a polypeptide having a mannanase activity at least 70% identical to the amino acid sequence of SEQ ID NO: 6; (d) a molecule complementary to (a), (b) or (c); And (e) an isolated polypeptide having a mannanase activity selected from the group consisting of synonymous nucleotide sequences of (a), (b), (c) or (d). Justice Before discussing the invention in more detail, the following terms are first defined. The term "ortholog" (or "spologue") refers to a polypeptide or protein obtained from one species that is similar to a similar polypeptide or protein from a different species. The term "paralog" refers to a polypeptide or protein obtained from a given species that is similar to a unique polypeptide or protein from the same species. The term “expression vector” refers to a linear or cyclic DNA molecule comprising a fragment encoding a polypeptide of interest operably linked to additional fragments provided for transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more optional markers, enhancers, polyadenylation signals, and the like. Expression vectors are generally derived from plasmid or viral DNA or may contain elements of both. The expression vector of the present invention can be any expression vector for convenience in recombinant DNA processes, and the choice of vector can often depend on the host cell into which the vector is introduced. Thus, the vector may be a spontaneous replication vector, ie, a vector, such as a plasmid, in which the replication exists as an extra chromosomal entity that is separate from chromosomal replication. In addition, the vector may be one that, when introduced into the host cell, replicates with the chromosome (s) integrated and integrated into the host cell genome. The term "recombinant expression" or "recombinant expression" as used herein in the context of expression of a polypeptide or protein is defined according to standard definition in the art. Recombinant expression of the protein is generally performed by using the expression vector defined immediately above. The term "isolated" means that when applied to a polynucleotide molecule, the polynucleotide is removed from its natural genetic environment so that it does not contain another exogenous or unwanted coding sequence and is intended for use in a genetically operated protein production system. Refers to a suitable form. Such isolated molecules are molecules isolated from their natural environment and include cDNA and genomic clones. Isolated DNA molecules of the invention typically do not contain another gene to which they are associated, but may include naturally occurring 5 'and 3' untranslated regions such as promoters and terminators. Identification of related areas will be apparent to those skilled in the art (Dynan and Tijan, Nature 316: 774-78, 1985). The term “isolated polynucleotide” may also be referred to as “cloned polynucleotide”. When applied to a protein / polypeptide, the term “isolated” indicates that the protein is found under conditions other than its natural environment. In a preferred form, the isolated protein is substantially free of another protein, especially another analogous protein (ie, "similar impurities" (see below)). It is preferred to provide the protein in at least 40% pure form, more preferably in at least 60% pure form. Even more preferably, as determined by SDS-PAGE, the protein is in highly purified form, ie, at least 80% pure form, more preferably at least 95%, even more preferably at least 99% pure form. It is desirable to provide. The term “isolated protein / polypeptide” may also be referred to as “purified protein / polypeptide”. The term “similar impurities” means all impurities that arise from the similar cell from which the polypeptide of the invention is originally obtained (eg, another polypeptide other than the polypeptide of the invention). The term "obtained from" as used herein in connection with a particular microbial source means that the polynucleotide and / or polypeptide is produced by a cell that is inserted by a particular source or into a gene from the source. When referring to a DNA fragment, the term “operably linked” means that the fragment is aligned such that, for example, transcription begins at the promoter and proceeds to the terminator through the coding fragment so that the fragment functions in accordance with its intended purpose. . The term "polynucleotide" refers to a single- or double-helix polymer of deoxyribonucleotide or ribonucleotide base that is read from the 5 'to 3' end. Polynucleotides include RNA and DNA and can be isolated from natural sources and synthesized in vitro or produced in combination with natural and synthetic molecules. The term “complement of polynucleotide molecule” refers to a polynucleotide molecule having a complementary base sequence and a reversible orientation compared to a reference sequence. For example, the sequence 5 'ATGCACGGG 3' is complementary to 5 'CCCGTGCAT 3'. The term “synonymous nucleotide sequence” refers to a sequence of nucleotides comprising one or more synonymous codons (as compared to a reference polynucleotide molecule encoding a polypeptide). Synonymous codons contain different triplets of nucleotides, but encode the same amino acid residues (ie, the GAU and GAC triplets each encode Asp). The term “promoter” refers to a portion of a gene containing a DNA sequence provided for binding of RNA polymerase and initiation of transcription. Promoter sequences are typically found in the 5 'noncoding region of a gene, but not always. The term “secretory signal sequence” refers to a DNA sequence that, as a component of a larger polypeptide, encodes a polypeptide (“secretory peptide”) that is directly linked to the larger polypeptide through the secretory pathway of the cell from which the polypeptide is synthesized. Larger peptides are typically degraded to remove secretory peptides while passing through the secretory pathway. Methods of Obtaining Another Related Sequence Using Sequences of the Invention: The sequence information described herein in relation to the polynucleotide sequence encoding the metase of the present invention can be used as a tool to identify another similar metase. For example, polymerase chain reaction (PCR) can be used to amplify a sequence encoding another similar mannanase from various microbial sources, especially from different Bacillus species. Assay for active test Polypeptides of the invention having mannase activity can be prepared according to standard test procedures known in the art, for example, agar plates containing 0.2% AZCL galactomannan [carob], i. Endo-1,4 available as CatNo.I-AZGMA (manufactured by Megazyme, Megazyme's Internet address: http://www.megazyme.com/Purchase/index.html) for US $ 110.00 per 3g Tests for mannase activity can be performed by application to 4 mm diameter pores perforated in the substrate for analysis of -beta-D-mannanase. Polynucleotides: Isolated polynucleotides of the invention can be hybridized to regions of similar size in SEQ ID NO: 1 or to sequences complementary thereto under minimal media deprivation conditions. In particular, the polynucleotides of the present invention have a length of about 100 base pairs, or the complete sequence shown at position 971029 of SEQ ID NO: 1 under minimal media deficient conditions, preferably highly deficient conditions, as described in detail below. Hybridized with a denatured double helix DNA probe comprising all probes comprising the subsequence of SEQ ID NO: 1. Suitable test conditions for hybridization in the medium or for measuring high deficiency between nucleotide probes and similar DNA or RNA sequences are DNA fragments for hybridization at 5 × SSC (sodium chloride / sodium citrate, Sambrook et al., 1989) for 10 minutes. Or preimmersion of a filter containing RNA, and 5 × SSC solution, 5 × Denhardt solution (Sambrook et al., 1989), 0.5% SDS and 100 μg / ml denatured sonicated sperm DNA (Sambrook et al. , Pre-hybridization of the filter in 1989, followed by random-prime at a concentration of 10 ng / ml (Feinberg, AP). And Vogelstein, B. (1983) Anal. Biochem. 132: 6-13] and hybridization in the same solution containing 32P-dCTP-labeled (inactive above 1 × 10 9 cpm / μg) probe at about 45 ° C. for 12 hours. The filter is then subjected to 60 ° C. or higher (medium deficiency), even more preferably 65 ° C. or higher (medium / high deficiency), even more preferably 70 ° C. or higher (high deficiency), even more preferably 75 Rinse twice for 30 min at 2 x SSC, 0.5% SDS above < RTI ID = 0.0 > Molecules in which oligonucleotide probes hybridize under these conditions are detected using x-ray films. As mentioned above, the isolated polynucleotides of the present invention include DNA and RNA. Methods of separating DNA and RNA are well known in the art. DNA and RNA encoding the genes of interest can be cloned in Gene Bank or DNA libraries by methods known in the art. Polynucleotides encoding polypeptides having a metase activity of the present invention can be identified and separated, for example, by hybridization or PCR. The invention also provides counterpart polypeptides and polynucleotides (orthologs or paralogs) from different bacterial strains. Particular preference is given to nanase polypeptides from a Gram-positive alkalescent strain comprising Bacillus spp. Species analogs of polypeptides having a metase activity of the invention can be cloned using the information and compositions provided by the invention in combination with conventional cloning techniques. For example, the DNA sequences of the present invention can be cloned using chromosomal DNA obtained from cell types expressing proteins. Suitable sources of DNA can be identified by probing the northern blot using probes designed from the sequences described herein. The library is then prepared from chromosomal DNA of the positive cell line. The DNA sequence of the present invention, which encodes a polypeptide having mannase activity, is then used in various methods, for example, using a probe designed from sequences described in the specification and claims of the present invention or based on the described sequence. It can be separated by probing using one or more sets of probes. The DNA sequences of the invention can also be cloned using polymerase chain reaction or PCR (Mullis, US Pat. No. 4,683,202) and using primers designed from the sequences described herein. Within further methods, a DNA library can be used to transform or transfect host cells, and the expression of the desired DNA is cloned from B.Agarardherens, NCIMB 40482 and used in the materials and methods of Example 1. It can be detected using antibodies raised against the expressed and purified mannanases as described (monoclonal or polyclonal), or by activity tests on polypeptides with mannanase activity. The DNA sequence cloned with plasmid pSJ1678 present in Escherichia coli DSM 12180 and / or the metase-encoding portion of the analog DNA sequence of the present invention produces an enzyme having met degradation activity or another microorganism or related microorganism described herein. Can be cloned from a strain of bacterial species Bacillus agaradherens, preferably strain NCIMB 40482. Similar sequences can also be constructed based on DNA sequences obtainable from plasmids present in Escherichia coli DSM 12180, which are believed to be identical to attached SEQ ID NO: 1, for example, subsequences thereof. / Does not generate another amino acid sequence of the metnanase encoded by the DNA sequence, but the introduction of nucleotide substitutions corresponding to the codon use of the host microorganism for the purpose of preparing the enzyme, or a different amino acid sequence (ie, May be constructed by the introduction of nucleotide substitutions that may not result in a modification of the metase. Polypeptides: The sequences of amino acid numbers 32 to 343 of SEQ ID NO: 2 are aging mannanase sequences. The present invention also provides a metnase polypeptide substantially similar to the polypeptide of SEQ ID NO: 2 and its species homologs (paralog or ortholog). The term “substantially similar” herein refers to 70%, preferably at least 80%, more preferably at least 85%, even more preferred to the sequence shown in amino acid numbers 32 to 343 of SEQ ID NO: 2 or orthologs or paralogs thereof. Preferably at least 90% identical. Such polypeptides may be more preferably at least 95%, most preferably at least 98% identical to the sequence shown in amino acid numbers 32 to 343 or their orthologs or paralogs of SEQ ID NO: 2. Percent sequence identity can be found in Needleman, S.B. And GCG Program Package (Program Manual of Wisconsin Package, Version 8, August 1994, Genetics Computer Group, USA 53711 Wisconsin) as described in Wunsch, CD, (1970), Journal of Molecular Biology, 48, 443-453. It is measured by conventional methods in the manner of computer programs known in the art, such as the GAP provided in Madison Science Drive 575. GAP is used with settings for comparing polypeptide sequences: a GAP creation penalty of 3.0 and a GAP extension penalty of 0.1. Sequence identity of polynucleotide molecules is determined by a similar method using GAP with a setting for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3. The enzyme preparations of the invention are preferably microorganisms, preferably bacteria, archeas or fungi, in particular bacteria, for example Bacillus, preferably species Bacillus agaradherens, and all species preferably aligned. Derived from a bacterium belonging to an alkaline bacillus strain that may be selected from the group consisting of highly related Bacillus species that are at least 95%, even more preferably at least 98% similar to Bacillus agaradherens based on the 16S rDNA sequence. . Substantially similar proteins and polypeptides are characterized by having one or more amino acid substitutions, deletions or additions. These changes are preferably conservative amino acid substitutions (see Table 2) and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; Small deletions of typically 1 to about 30 amino acids; And small amino- or carboxyl-terminal extensions, eg, amino-terminal methionine residues, small linker peptides of about 20 to 25 or less residues, or small extensions (affinity markers) to facilitate purification, eg, Poly-histidine tract, a small property that is protein A (Nilsson et al., EMBO J. 4: 1075, 1985; Nilsson et al., Methods Enzymol. 198: 3, 1991; Ford et al., Protein Expression and Purification 2: 95-107, 1991, which is hereby incorporated by reference. DNA coding affinity labels are available from commercial suppliers [Pharmacia Biotech, Piscataway, NJ; New England Biolabs, Beverly, MA]. However, although the changes described above are preferably small properties, these changes may be larger properties, such as fusion of larger polypeptides of up to 300 amino acids or amino- or carboxyl-terminal expansion to the met kinase polypeptide of the invention. have. Table 1 Conservative Amino Acid Substitutions BasicArginine, lysine, histidine acidGlutamic Acid, Aspartic Acid polarityGlutamine, Asparagine HydrophobicLeucine, Isoleucine, Valine directionalPhenylalanine, Tryptophan, Tyrosine small typeGlycine, alanine, serine, threonine, methionine In addition to the 20 standard amino acids, non-standard amino acids such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline and a-methylserine are substituted for amino acid residues of the polypeptides according to the invention. Can be. A limited number of non-conservative amino acids, and non-natural amino acids, which are amino acids not encoded by the genetic code, can be substituted for amino acid residues. “Non-natural amino acids” are modified after protein synthesis and / or have a chemical structure different from that of standard amino acids in their side chain (s). Non-natural amino acids can be chemically synthesized or are preferably marketed and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline and 3,3-dimethylproline. Essential amino acids in the metase polypeptides of the invention can be identified according to methods known in the art, for example site-specific mutagenesis or alanine-scanning mutagenesis. Cunningham and Wells, Science 244: 1081 -1085, 1989]. In the latter technique, a single alanine mutation is introduced at every residue in the molecule, and the resulting mutant molecule is tested for biological activity (ie, met kinase activity) to identify amino acid residues that are critical to the activity of the molecule. Reference: Hilton et al., J. Biol. Chem. 271: 4699-4708, 1996. In addition, the active site or another biological interaction of an enzyme was determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling in connection with the putative contact site amino acid mutations. As can be measured by physical analysis of the structure. References: de Vos et al., Science 255: 306-312, 1992; Smith et al., J. Mol. Biol. 224: 899-904, 1992; Wlodaver et al., FEBS Lett. 309: 59-64, 1992. In addition, the identity of essential amino acids can be deduced from analysis of identity with polypeptides related to polypeptides according to the invention. Multi-amino acid substitutions are known methods of reorganization involving mutagenesis, recombination and / or corresponding screening methods, for example Reidhaar-Olson and Sauer (Science 241: 53-57, 1988), Bowie and Saucer (Proc. Natl. Acad. Sci. USA 86: 2152-2156, 1989), WO 95/17413 or WO 95/22625, can be performed and tested. In summary, these authors describe methods for randomizing two or more positions in a polypeptide at the same time, or for recombination / recombination of different mutants [WO 95/17413, WO 95/22625] following functional polypeptides. Following selection, a method of sequencing the mutated polypeptide to determine the spectrum of acceptable substitutions at each position is described. Another method that can be used is phage display [Lowman et al., Biochem. 30: 10832-10837, 1991; Ladner et al., US Pat. No. 5,223,409; Huse, WIPO Publication WO 92/06204] and region-specific mutagenesis (Derbyshire et al., Gene 46: 145, 1986; Ner et al., DNA 7: 127, 1988]. Mutagenesis / reorganization methods as described above can be combined with high throughput automated screening methods to detect the activity of cloned and mutated polypeptides in host cells. Mutated DNA molecules encoding active polypeptides can be regenerated from host cells and rapidly sequenced using modern devices. These methods allow for the rapid determination of the importance of individual amino acid residues in a desired polypeptide and can be applied to polypeptides of unknown structure. Using the methods described above, one of ordinary skill in the art can identify and / or prepare a variety of polypeptides substantially similar to residues 32 to 343 of SEQ ID NO: 2 and maintain the metase activity of the wild type protein. Protein manufacturing: Proteins and polypeptides of the invention, including full length proteins, fragments thereof and fusion proteins, can be prepared in host cells genetically operated according to conventional techniques. Suitable host cells are cell types that can be transformed or transfected using exogenous DNA and grown in media, including bacteria, fungal cells, and cultured highly eukaryotic cells. Preferred are bacterial cells, especially cultured cells of gram-positive microorganisms. Gram-positive cells from Bacillus spp. Are particularly preferred, for example Bacillus subtilis, Bacillus lentus, Bacillus brevis, Bacillus stearotermophilus, Bacillus alcalophilus. alkalophilus, Bacillus amyloquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus thuringiensis, Bacillus richeni Bacillus licheniformis and Bacillus agaradherens, in particular Bacillus agaradherens. Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into various host cells are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al., (Eds.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY, 1987; and "Bacillus subtilis and Other Gram-Positive Bacteria", Sonensheim et al., 1993, American Society for Microbiology, Washington D.C. In general, the DNA sequences encoding the metases of the present invention are operably linked to other genetic elements generally required for their expression, including transcriptional promoters and terminators, in expression vectors. Although those skilled in the art can recognize that within a particular system a selectable marker can be provided for a separate vector and that replication of exogenous DNA can be provided by integration into the host cell genome, the vector It may also typically contain one or more selectable markers and one or more origins of replication. The selection of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of those skilled in the art. Many of these elements are described in the literature and are available from commercial suppliers. In order to direct the polypeptide to the secretory pathway of the host cell, a secretory signal sequence (also known as leader sequence, prepro sequence or pre sequence) is provided in the expression vector. The secretory signal sequence can be the sequence of a polypeptide, or can be derived from another secreted protein or newly synthesized. Many suitable secretory signal sequences are known in the art and are described in detail in "Bacillus subtilis and Other Gram-Positive Bacteria", Sonensheim et al., In particular for further description of secretory signal sequences suitable for secretion in Bacillus host cells. , 1993, American Society for Microbiology, Washington DC; And Cutting, S.M. (eds.) "Molecular Biological Methods for Bacillus", John Wiley and Sons, 1990. Secretory signal sequences are involved in the DNA sequence in the correct reading frame. Although specific signal sequences can be located anywhere in the DNA sequence of interest, secretory signal sequences are typically located 5 'to the DNA sequence encoding the polypeptide of interest. Welch et al., US Pat. No. 5,037,743 number; Holland et al., US Pat. No. 5,143,830]. Transformed or transfected host cells are cultured according to conventional methods in a culture medium containing nutrients and other ingredients necessary for the growth of the selected host cell. Various suitable media, including defined media and complex media, are known in the art and generally include carbon sources, nitrogen sources, essential amino acids, vitamins, and minerals. In addition, the medium may contain ingredients such as growth factors or serum, if necessary. In general, growth media is deficient in essential nutrients supplemented with selectable markers performed on, for example, drug selection or expression vectors, or cotransfected into host cells, to cells containing exogenously added DNA. Can be selected. Protein Isolation: If the expressed recombinant polypeptide is secreted, the polypeptide can be purified from the growth medium. Preferably, the expression host cell is removed from the medium (eg, by centrifugation) prior to purification of the polypeptide. If the expressed recombinant polypeptide is not secreted from the host cell, the host cell is preferably degraded and the polypeptide is released into an aqueous “extract” which is the first step in this purification technique. Preferably, the expression host cell is recovered from the medium (eg, by centrifugation) prior to cell degradation. Cytolysis can be performed by conventional techniques such as lysosomal digestion or pressing of cells via high pressure. For further explanation of these cell lysis techniques, see Robert K. Scobes, Protein Purification, Second edition, Springer-Verlag. Depending on whether the expressed recombinant polypeptide is secreted or not, it can be fractionated and / or purified using conventional purification methods and media. Ammonium sulfate precipitation and acid or chaotrope extraction can be used for fractionation of the samples. Exemplary tableting steps can include hydroxyapatite, size extrusion, FPLC, and reversible phase high performance liquid chromatography. Suitable anion exchange media include derivatized dextran, agarose, cellulose, polyacrylamide, special silica and the like. PEI, DEAE, QAE and Q derivatives are preferred, DEAE Fast-Flow Sepharose (PharmaPharma, Piscataway, NJ) is particularly preferred. Exemplary chromatographic media are media derived using phenyl, butyl or octyl groups, for example phenyl-sepharose FF from Pharmacia, Toyopearl butyl 650 from Toso Haas, Montgomeryville. , PA], octyl-sepharose [manufacturer; Pharmacia] and the like; Or polyacrylic acid resins such as Amberchrom CG 71 (Toso Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, crosslinked agarose beads, polystyrene beads, crosslinked polyacrylamide resins, and the like, which are insoluble under the conditions used. These supports may be modified using reactive groups that allow for the attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxy groups and / or carbohydrate moieties. Examples of coupling chemicals include carboxyl for cyanogen bromide actives, N-hydroxysuccinimide actives, epoxide actives, sulfhydryl actives, hydrazide actives, and carbodiimide coupling chemicals. And amino derivatives. These and other solid media are well known and widely used in the art and are available from commercial suppliers. The choice of a particular method is a matter of everyday design and is in part determined by the nature of the chosen support. Reference: Affinity Chromatography: Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988. Polypeptides or fragments thereof of the invention can also be prepared via chemical synthesis. Polypeptides of the invention can be monomers or multimers; Can be glycosylated or aglycosylated; Can be pegylated or non-pegylated; It may or may not include an initial methionine amino acid residue. Based on the sequence information described herein, a full length DNA sequence encoding the metase of the invention and comprising the DNA sequence shown in SEQ ID NO: 1, the minimal DNA sequence from position 97 to position 1029 can be cloned. have. Cloning ■ preparation of a genomic library from Bacillus strains, in particular strain B. agaradherens, NCIMB40482; Plating of the library on a suitable substrate plate; ■ identification of clones comprising polynucleotide sequences of the invention by standard hybridization techniques using probes based on SEQ ID NO: 1; or ■ by standard methods known in the art, such as the identification of clones from the Bacillus agaradherens NCIMB 40482 genomic library by reverse PCR methods using primers based on sequence information from SEQ ID NO: 1. For further explanation regarding reverse PCR see M.J. MCPherson et al. ("PCR A practical approach" Information Press Ltd, Oxford England). Based on the sequence information described herein (SEQ ID NO: 1, SEQ ID NO: 2), analogous polynucleotide sequences encoding analogous mannanases of the present invention can be derived from other microbial organisms, particularly species of Bacillus, such as the alkaline species of Bacillus. Separation by similar methods using genomic libraries from genomic libraries from strains is routine for those skilled in the art. In addition, the DNA encoding the metnan or galactomannan-degrading enzyme of the present invention is based on DNA sequences obtainable from plasmids present in Escherichia coli DSM 12180 from suitable sources such as all of the above-mentioned organisms according to well known methods. Can be cloned using the synthetic oligonucleotide probe prepared as. Thus, the polynucleotide molecules of the present invention can be isolated from Escherichia coli, DSM 12180, on which plasmids obtained by cloning are deposited as described above. The present invention also relates to an isolated and substantially pure biological medium of strain Escherichia coli, DSM 12180. As used herein, the term “enzyme preparation” refers to conventional enzymatic fermentation products, eg, preparations comprising a large number of different enzymatic activities, from a single species of microorganism, possibly isolated and purified; Or derived from monocomponent enzymes, preferably bacterial or fungal species, using conventional recombinant techniques, fermented and possibly separated and purified, respectively, and may arise from different species, preferably fungal or bacterial species Mixtures of enzymes; Or a fermentation product of a microorganism that acts as a host cell for the expression of a recombinant mannanase. The microorganisms then simultaneously produce another enzyme that naturally generates the fermentation product of the microorganism, for example, pectin degrading enzymes, proteases or cellulases, ie enzyme complexes conventionally produced by the corresponding naturally occurring microorganisms. The method for preparing an enzyme preparation of the present invention includes culturing a microorganism, for example, a wild type strain, capable of preparing a metase and recovering the enzyme from the culture under conditions permitting the preparation of the enzyme. Cultivation can be performed by conventional fermentation techniques, such as by culturing in shake flasks or fermentors with agitation to ensure sufficient aeration in the growth medium leading to the preparation of the metnanase enzyme. The growth medium may be a conventional N source such as peptone, yeast extract or casamino acid, a reduced amount of conventional C source such as dextrose or sucrose, and a source of induction such as guar gum or locust May contain soy gum. Recovery may be accomplished by conventional techniques such as separation of biomass and supernatant by centrifugation or filtration, recovery of the supernatant or by adding the desired enzyme intracellularly and possibly as described in EP 0 406 314. Cell lysis in the presence of purification, or by crystallization as described in WO 97/15660. Immune Cross-Reactivity: Polyclonal antibodies used in the determination of immunological cross-reactivity can be prepared using purified mannanase enzymes. More specifically, the antiserum against the metase of the present invention is described in N. Axelsen et al., A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (more specifically, p. 27-31)] can be generated by immunizing the rabbit (or another rodent). Purified immunoglobulins can be obtained from antisera, for example by salt precipitation ((NH 4 ) 2 SO 4 ), for example by dialysis and ion exchange chromatography on DEAE-Sepadex. Immunoglobulin characterization of proteins is described in the Outcherlony double-diffusion assay [O.Ouchterlony, Handbook of Experimental Immunology (DM Weir, Ed.), Blackwell Scientific Publications, 1967, pp. 655-706], cross-immunoelectrophoresis (N. Axelsen et al., Supra Chapters 3 and 4) or rocket immunoelectrophoresis [N. Axelsen et al., Chapter 2]. Examples of useful bacteria for preparing the enzymes or enzyme preparations of the invention are preferably Gram positive bacteria from the Bacillus / Lactobacillus moiety, preferably strains from the species Bacillus, more preferably strains of Bacillus agaradherens, In particular strain Bacillus agaradherens, NCIMB 40482. The present invention includes isolated mannanases having the properties described above and containing no similar impurities, and are prepared using conventional recombinant techniques. Determination of Catalytic Activity (ManU) of Mannanase Colorimetric analysis: Substrate: 0.2% AZCL-galactomannan from carob in 0.1 M glycine buffer at pH 10.0 from Megazim, Australia. The analysis is carried out in a 1.5 ml Eppendorf microtube on a thermomixer with stirring and temperature control at 40 ° C. 0.750 ml of substrate with 0.05 ml of enzyme was incubated for 20 minutes and stopped by centrifugation for 4 minutes at 15000 rpm. The color of the supernatant is measured at 600 nm in 1 cm cuvette. One ManU (mannanase unit) is 0.24abs at 1 cm. Obtained Bacillus agaradherence metase NCIMB 40482 Strain Bacillus agaradherens NCIMB 40482 contains a metase enzyme that encodes a DNA sequence. E. coli strain: cells of E. coli SJ2 [Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, BR, Sjoholm, C. (1990) Cloning of al dB, which encodes alpha-acetolactate decarboxylase, an exoenzyme from Bacillus brevis. J. Bacteriol., 172, 4315-4321] and transform using a Gene Pulser ™ electroporator (BIO-RAD) as described by the supplier. B. Subtilis PL2306. This strain is a dividing apr and npr gene that is cleaved in the transcriptional unit of the known Bacillus subtilis cellulase gene, which provides cellulase negative cells [Diderichsen, B., Wedsted, U., Hedegaard, L. , Jensen, BR, Sjoholm, C. (1990) Cloning of al dB, which encodes alpha-acetolactate decarboxylase, an exoenzyme from Bacillus brevis. J. Bacteriol., 172, 4315-4321] B. subtilis DN 1885. Cleavage is essentially described in Eds. A.L. Sonenshein, J.A. Hoch and Richard Losick (1993) Bacillus subtilis and other Gram-Positive Bacteria, American Society for microbiology, p. 618. Suitable cells are described in Yasbin, R.E., Wilson, G.A. And Young, F.E. (1975), Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. And transformed as described in J. Bacteriol, 121: 296-304. Plasmid pSJ1678 (as described in detail in WO 94/19454, which is hereby incorporated by reference in its entirety). pMOL944: This plasmid is pUB110, which contains an element for making a plasmid that is proliferable in Bacillus subtilis, a kinamycin resistance gene and a signal peptide cloned from the amyL gene of B. rickeniformis ATCC14580. The signal peptide contains a SacII site that facilitates cloning of the DNA encoding the ripening portion of the fusion in protein with the signal peptide. This results in the expression of pre-proteins that are directed out of the cell. Plasmids are constructed by conventional genetic engineering techniques, which are briefly described below. pMOL944's work: The pUB110 plasmid (McKenzie, T. et al., 1986, Plasmid 15: 93-103) is digested with a single restriction enzyme Ncil. Plasmid pDN1981 [see: P.L. PCR fragments amplified from the amyL promoter encoded by Jorgensen et al., 1990, Gene, 96, p37-41] were digested with Ncil and inserted into Ncil digested pUB110 to obtain plasmid pSJ2624. The two PCR primers used have the following sequence: # LWN5494 5'- GTCGCCGGGGCGGCCGCTATCAATTGGTAACTGTATCTCAGC-3 ' # LWN5495 5'- GTCGCCCGGGAGCTCTGATCAGGTACCAAGCTTGTCGACCTGCAGAA TGAGGCAGCAAGAAGAT-3 ' Primer # LWN5494 is inserted at the NotI site in the plasmid. The plasmid pSJ2624 is then digested with SacI and NotI and the new PCR fragment amplified in the amyL promoter encoded at pDN1981 is digested with SacI and NotI and the DNA fragment is inserted into SacI-NotI digested pSJ2624 to obtain plasmid pSJ2670. This cloning uses the same promoter but replaces the first amyL promoter cloning in the opposite direction. The two primers used for PCR amplification have the following sequence: # LWN5938 5'- GTCGGCGGCCGCTGATCACGTACCAAGCTTGTCGACCTGCAGAATG AGGCAGCAAGAAGAT-3 ' # LWN5939 5'-GTCGGAGCTCTATCAATTGGTAACTGTATCTCAGC-3 ' PCR fragment amplified from a cloned DNA sequence that digests plasmid pSJ2670 with restriction enzymes PstI and BclI and encodes alkaline amylase SP722, which is described in its entirety in International Patent Application WO 95/26397, which is incorporated herein by reference. Is digested with PstI and BclI and inserted to give plasmid pMOL944. The two primers used for PCR amplification have the following sequence: # LWN7864 5'-AACAGCTGATCACGACTGATCTTTTAGCTTGGCAC-3 ' # LWN7901 5'-AACTGCAGCCGCGGCACATCATAATGGGACAAATGGG-3 ' Primer # LWN7901 is inserted at the SacII site in the plasmid. Cloning of the Mannase Gene from Bacillus Agaradherens Genomic DNA Preparation: Strain Bacillus agaradherens NCIMB 40482 is grown in liquid medium as described in WO 94/01532. After 16 hours of incubation at 30 ° C. and 300 rpm, cells were collected and Pitcher et al. Described in Pitcher, D. G., Saunders, N. A., Owen, R. J. (1989). Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol., 8, 151-156, is used to isolate genomic DNA. Genome library construction: Genomic DNA is partially digested using restriction enzyme Sau3A and size- fractionated by electrophoresis on 0.7% agarose gel. Fragments 2 to 7 kb in size are separated into DEAE-cellulose paper by electrophoresis [Dretzen, G., Bellard, M., Sassone-Corsi, P., Chambon, P. (1981) A reliable method for the recovery of DNA fragments from agarose and acrylamide gels.Anal. Biochem., 112, 295-298. The isolated DNA fragments are ligated with BamHI digested pSJ1678 plasmid DNA and the ligation mixture is used to transform E. coli SJ2. Positive Clone Identification: DNA libraries in E. coli constructed as described above are screened in LB agar plates containing 0.2% AZCL-galactomannan (megazine) and 9 μg / ml chloramphenicol and incubated overnight at 37 ° C. . Clones expressing mannase activity appear with blue diffuse halo. Qiagen plasmid spin propept on 1 ml of culture broth (cells cultured at 37 ° C. in TY with overnight at 9 μg / ml chloramphenicol and shaking at 250 rpm) from one of these clones. To separate them. In addition, the clone (MB525) is characterized by DNA sequencing of the cloned Sau3A DNA fragment. DNA sequencing is performed by primerworking using a Taq deoxy-terminal cycle sequencing kit (Perkin-Elmer, USA), fluorescently labeled terminals and oligonucleotides suitable as primers. Analysis of sequence data can be found in Devereux et al. (1984) Nucleic Acids Res. 12, 387-395. The sequence encoding the metase is shown in SEQ ID NO: 1. The derived protein sequence is shown in SEQ ID NO: 2. Subcloning and Expression of Mannanase in B. subtilis: The metase encoding the DNA sequence of the present invention is PCR amplified using a PCR primer set consisting of the following two oligonucleotides: Mannanase Advanced SacII 5'-CAT TCT GCA GCC GCG GCA GCA AGT ACA GGC TTT TAT GTT GAT GG-3 ' Met Ane Lower NotI 5'-GAC GAC GTA CAA GCG GCC GCG CTA TTT CCC TAA CAT GAT GAT ATT TTC G-3 ' Restriction sites SacII and NotII are underlined. Chromosome DNA isolated from B. agaradherens NCIMB 40482 as described above is used as a template in a PCR reaction using amplitag DNA polymerase (Perkin Elmer) according to the manufacturer's instructions. PCR reactions consisted of PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl 2) containing 200 μM of each dNTP, 2.5 units of amplitag polymerase (Perkin-Elmer, Cetus, USA) and 100 pmol of each primer. , 0.01% (w / v) gelatin). PCR reactions are performed using a DNA heat cycler (Landgraf, Germany). The PCR is circulated 30 times by incubating 1 minute at 94 ° C., then using a cycle profile for denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 1 minute, and expanding at 72 ° C. for 2 minutes. 25 μl aliquots of amplification products are analyzed by electrophoresis on 0.7% agarose gel (NuSieve, FMC). Appearance of 1.4 kb of DNA fragment size indicates suitable amplification of the gene fragment. Subcloning of PCR Fragments 25 μl aliquots of the PCR product generated as described above are purified using the QIAquick PCR Purification Kit (Qiagen, USA) according to the manufacturer's instructions. Purified DNA is eluted with 50 μl of 10 mM Tris-HCl at pH 8.5. 5 μg of pMOL944 and 25 μl of purified PCR fragment were digested using SacII and NotI, electrophoresed on a low gelling temperature of 0.8% agarose gel (SeaPlaque GTG, FMC) and the corresponding fragments were run from the gel. Purify using QIAquick gel extraction kit (Qiagen, USA) according to manufacturer's instructions. The isolated PCR DNA fragment is then ligated with digested SacII-NotI and purified pMOL944. Ligation is performed overnight at 16 ° C. using 0.5 μg of each DNA fragment, T4 DNA ligase 1U and T4 ligase buffer (Boehringer Mannheim, Germany). The ligation mixture is used to transform a suitable B. subtilis PL2306. Transformed cells are plated in LBPG-10 μg / ml in Kanamycin plates. After 18 hours of incubation at 37 ° C., colonies are seen on the plate. Several colonies are analyzed by separating plasmid DNA from culture broth overnight. These positive clones are re-stripped several times in agar plates as used above, which clones are called MB594. Clone MB594 was grown overnight at TY-10 μg / ml kanamycin at 37 ° C. and the plasmids were removed from cells using 1 ml of cells the next day according to the manufacturer's instructions for B. Bacillus plasmid preparation. Isolate using Qiaprep Spin Plasmid Miniprep Kit) # 27106. The DNA represents the DNA sequence that corresponds to the mature portion of the metase, ie, positions 94-1404 of attached SEQ ID NO: 3. Derived ripening protein is shown in SEQ ID NO: 4. This may indicate that the 3 ′ end of the mannase encoded by the sequence of SEQ ID NO: 1 changes to that shown in SEQ ID NO: 3 due to the design of the lower primer used in the PCR. The amino acid sequence obtained is shown in SEQ ID NO: 4, and it is clear that the C terminus (SHHVREIGVQFSAADNSSGQTALYVDNVTLR) of SEQ ID NO: 2 is changed to the C terminus (IIMLGK) of SEQ ID NO: 4. badge: TY (as described in Ausubel, F.M. et al. "Current protocols in Molecular Biology", John Wiley and Sons, 1995). LB agar (as described in Ausubel, F.M. et al. "Current protocols in Molecular Biology", John Wiley and Sons, 1995). LBPG is LB agar supplemented with 0.05% calcium phosphate at 0.5% glucose and pH 7.0 (see above). BPX medium is described in EP 0 506 780 (WO 91/09129). Expression, Purification and Characterization of Mannanases from Bacillus Agarardherens Clone MB 594 obtained as described above under this material and method is grown in 25 × 200 ml BPX medium with 10 μg / ml of kanamycin for 5 days at 300 rpm and 37 ° C. in two 500 ml volumes of baffle shake flasks. Recover 6500 ml of shake flask culture fluid of clone MB 594 (batch 9813) and adjust the pH to 5.5. 146 ml of cationic (C521) and 292 ml of anionic (A130) are added while stirring the aggregates. The aggregated material is separated by centrifugation using a Sorval RC 3B centrifuge at 9000 rpm for 20 minutes at 6 ° C. The supernatant is purified using Whatman glass filters GF / D and C and finally concentrated on filtron with 10 kDa cuts. 750 ml of this concentrate is applied to pH 7.5 using sodium hydroxide. The clear solution is subjected to anion-exchange chromatography using 900 ml Q-Sepharose column equilibrated with 50 mmol Tris at pH 7.5. Mannanase activity boundaries are eluted using a sodium chloride gradient. Pure enzymes provide single bonds in SDS-PAGE with a molecular weight of 38 kDa. The amino acid sequence of the mannase enzyme, ie the isolated DNA sequence, is shown in SEQ ID NO: 2. Measurement of Kinetic Constants: Substrates: Locus Bean Gum (Carob) and Reducing Sugar Assay (PHBAH). Locus Bean Gum from Sigma (G-0753) Kinetic measurements using different concentrations of Locus bean gum and incubation for 20 minutes at pH 10 and 40 ° C. provide the following results: Kcat: 467 per second K m : 0.08g per I MW: 3.8kDa pI (isoelectric point): 4.2 The optimum temperature of the metase was found to be 60 ° C. The pH activity profile shows maximum activity at pH 8-10. The DSC differential scanning calorimeter shows 77 ° C. as a boiling point at pH 7.5 in Tris buffer, indicating that the enzyme is very thermally stable. Detergent miscibility using 0.2% AZCL-galactomannan from carobs as a substrate and incubated at 40 ° C. as described above shows excellent compatibility with conventional liquid detergents and good compatibility with conventional powdered detergents. Indicates. Obtaining Bacillus subtilis mannanase 168 Bacillus subtilis β-mannanase is characterized and identified as follows. The Bacillus subtilis genome is examined for homology with known Bacillus sp. Β-mannanase gene sequences (Mendoza et al., Biochemica et Biophysica Acta 1243: 552-554, 1995). The coding region of ydhT where the product is unknown showed 58% similarity to known Bacillus β-mannanases. Oligonucleotides: 5'-GCT CAA TTG GCG CAT ACT GTG TCG CCT GTG-3 'and 5'-GAC GGA TCC CGG ATT CAC TCA ACG ATT GGC G-3' are sequences for the mature part of the putative β-mannanase It is designed to amplify coding. Total genomic DNA from Bacillus subtilis strain 1A95 is used as a template to amplify the ydhT mature region using the primers described above. PCR is performed using a Gene-AMP PCR kit with AMPLITAQ DNA polymerase (Perkin Elmer, Applied Biosystems, Foster City, CA). 25 cycles are performed with a program of initial melting of 5 minutes at 95 ° C, followed by melting for 1 minute at 95 ° C, annealing for 2 minutes at 55 ° C, and extension for 2 minutes at 72 ° C. After the final cycle, the reaction is held at 72 ° C. for 10 minutes to fully expand. PCR products are purified using QIAquick PCR Purification Kit (Qiagen, Chatsworth, CA). The ydhT mature region amplified from Bacillus subtilis strain 1A95 is inserted into the expression vector pPG1524 (described above) as follows. The amplified 1028 bp fragment is digested with Mfe I and BamH I. Expression vector pPG1527 is digested with EcoR I and BamH I. Restriction products are purified using QIAquick PCR Purification Kit (Qiagen, Chatsworth, Calif.). Two fragments are ligated using T4 DNA ligase (13 hours, 16 ° C.) and used to transform the appropriate E. coli strain DH5-α. Ampicillin resistant colonies are incubated during DNA preparation. DNA is then characterized by restriction analysis. Plasmid pPG3200 contains the mature region of the ydhT gene. The plasmid pPG3200 is then used to transform the suitable Bacillus subtilis strain PG 632 (Saunders et al., 1992). 20/20/5 medium supplemented with 7 kanamycin resistant Bacillus subtilis clones and one PG 632 control clone and supplemented with 1 ml of 25% maltrine, 120 μl of 10 mM MnCl 2 and 20 μl of 50 mg / ml kanamycin (20 g / l tryptone, 20 g / l yeast extract, 5 g / l NaCl). Clones are grown overnight in 250 ml baffle flasks with shaking at 37 ° C. and 250 rpm for expression of the protein. Spin the cells for 15 minutes at 14,000 rpm. 1 μl of each supernatant is diluted in 99 μl of 50 mM sodium acetate (pH 6.0). 1 μl of this dilution is analyzed using Endo-1,4-β-Mannase beta-Mannzyme Taps (Megazyme, Ireland) according to the manufacturer's instructions. Absorbance is read at 590 nm on a Beckman DU640 spectrometer. Clone 7 shows the highest absorbance of 1.67. The PG632 control showed no absorbance at 590 nm. The supernatant is analyzed by SDS-PAGE on a 10-20% Tris-glycine gel (Novex, San Diego, Ca) to identify the desired 38 kDa size protein. Samples are prepared as follows. 500 μl sample of ydhT clone 7 and PG 632 supernatant were precipitated with 55.5 μl of 100% trichloroacetic acid (Sigma), washed with 100 μl of 5% trichloroacetic acid and resuspended in 50 μl of Tris-glycine SDS sample buffer (Novex) Boil for 5 minutes. 1 μl of each sample is electrophoresed at 30 mA for 90 minutes on the gel. Large protein bands were observed to operate at 38 kDa for ydhT clone 7. 10 L fermentation of Bacillus subtilis ydhT clone 7 is carried out in a B. Braun Biostat C fermenter. Fermentation conditions are as follows. Cells are grown for 18 hours at 37 ° C. in a rich medium similar to 20/20/5. At the end of the fermentation, cells are removed and the supernatant is concentrated to 1 L using a tangent flow filtration system. The final yield of β-mannanase in the concentrated supernatant is 3 g / l. Purification of β-mannanase from the fermentation supernatant is carried out as follows. 500 ml of the supernatant is centrifuged for 10 minutes at 10,000 rpm and 4 ° C. The centrifuged supernatant is then dialyzed overnight at 4 ° C. with 4 liters of 10 mM potassium phosphate (pH 7.2) twice (Spectrum) through a Spectraphor 12,000-14,000 mol weight cutoff membrane. The dialysed supernatant is centrifuged at 4O < 0 > C for 10 minutes at 10,000 rpm. The 200 mL Q Sepharose fast flow (Pharmacia) anion exchange resin column is equilibrated at 20 ° C. with 1 L of 10 mM potassium phosphate salt (pH 7.2) and 300 mL of the supernatant is loaded on the column. Two 210 ml fractions (Sample A) and 175 ml fractions (Sample B) are collected. The two assays were assayed as before except diluting with 199 μl of 50 mM sodium acetate (pH 6.0) and their absorbances were 0.38 and 0.52, respectively. Two μL of each sample is added to 8 μL of Tris-Glycine SDS Sample Buffer (Novex, CA) and boiled for 5 minutes. The obtained sample is electrophoresed at 30 mA for 90 minutes on a 10-20% Tris-glycine gel (Novex, Ca). A major band corresponding to 38 kDa is present in each sample and comprises at least 95% of the total protein. BCA Protein Assay (Pierce) is performed on both samples according to the manufacturer's instructions, using bovine serum albumin as standard. Samples A and B contain 1.3 mg / ml and 1.6 mg / ml, respectively, of β-mannanase. Identification of proteins is confirmed by ion injection mass spectrometry and amino terminal amino acid sequencing. Purified β-mannanase samples are used to characterize enzymatic activity as follows. All assays use Endo-1,4-β-Mannase Beta Manazime Taps as previously described (Megazyme, Ireland). Activity in the pH range 3.0 to 9.0 is performed in 50mM phosphate citrate buffer and activity measurement is measured in pH 9.5, 50mM CAPSO (Sigma) and using 50mM CAPS buffer in the range of pH 10.0-11.0. The optimum pH for Bacillus subtilis β-mannanase was found to be pH 6.0-6.5. The temperature activity profile is performed in 50 mM phosphate citrate buffer, pH 6.5. Enzymes exhibit optimal activity at temperatures between 40 and 45 ° C. Bacillus subtilis β-mannanase maintains significant activity below 15 ° C. and above 80 ° C. Inactivity to β-1,4-galactomannan was determined to be 160,000 μmol mg β-mannanase using the endo-1,4-β-mannanase beta manazime taps (Megazyme, Ireland) according to the manufacturer's instructions do. The nucleotide and amino acid sequences of the Bacillus subtilis β-mannanase are shown in SEQ ID NOs: 5 and 6. Mannanases are incorporated into the compositions of the present invention in an amount of preferably 0.0001% to 2%, more preferably 0.0005% to 0.1%, most preferably 0.001% to 0.02% by weight of the pure enzyme of the composition. In addition to an enzyme core comprising a catalytic moiety, the enzyme of the present invention includes a cellulose binding moiety (CBD), a cellulose binding moiety of an enzyme that is possibly bound, and an enzyme core (catalytically active moiety). The cellulose binding site (CBD) can be present as an integral part of the encoded enzyme or CBD from another origin can be introduced into the enzyme to form an enzyme hybrid. As used herein, the "cellulose binding site" is described by Peter Tomme et al. In "Cellulose-Binding Domains: Classification and Properties" in "Enzyme Degradation of Insoluble Carbohydrates", John N. Saddler and Michael H. Penner. (Eds.), ACS Symposium Series, No. 618, 1996]. In this definition, 120 cellulose-binding sites are classified into 10 species (IX) and CBD is found in various enzymes such as cellulase, xylanase, mannanase, arabinofuranosidase, acetyl esterase and chitinase. Indicates. CBD has also been found in egg ash (e.g., red agar porphyra pulpurea as a non hydrolyzable polysaccharide-binding protein) (Tomme et al., Op.cit.). However, most CBDs are from cellulase and xylanase and CBDs are found at or inside the N and C termini of the protein. Enzyme hybrids are known in the art (see WO 90/00609 and WO 95/16782), and in the presence or absence of a binder, one or more DNAs encoding cellulose binding sites bound to a DNA sequence encoding a mannase enzyme. DNA constructs comprising fragments can be prepared by transforming host cells and growing host cells to express the fused gene. Enzyme hybrids are of the formula CBD-MR-X, where CBD is the N-terminal or C-terminal portion of the amino acid sequence corresponding at least to the cellulose-binding site; MR is the middle region (conjugate), and is bound or preferably carbon number About 2 to about 100, more preferably a short bond group of 2 to 40 carbon atoms, or preferably about 2 to about 100 amino acids, more preferably 2 to 40 amino acids; It is N-terminal or C-terminal region of the enzyme). The enzymes described above may be present in any of the suitable origins, such as plant, animal, bacterial, fungal and yeast origin. The origin may further be mesophilic or cryogenic (frozen, non-cold, thermophilic, hypertonic, alkaline, eosinophil, basophilic, etc.). Such enzymes in purified or unpurified form may be used. Recently, modification of wild-type enzymes through protein / genetic engineering techniques is generally practiced to optimize performance efficiency in the cleaning compositions of the present invention. For example, variants can be designed to increase the compatibility of enzymes with components generally present in such compositions. Alternatively, the variant can be designed to suit the particular cleaning application by adjusting the optimum pH, bleaching or chelate stability, catalytic activity, etc. of the enzyme variant. In particular, in the case of bleaching stability, the surface charge for amino acid and surfactant compatibility that is sensitive to oxygen should be focused. The isoelectric point of such enzymes can be modified by substitution of some charged amino acids, for example increasing the isoelectric point can help to increase the compatibility with anionic surfactants. The stability of the enzyme can be further enhanced, for example, by the formation of additional metal binding sites to increase salt binding and chelate stability. Softening clay The second essential ingredient of the laundry detergent and / or fabric protection composition of the present invention is softened clay. Certain clays or mixtures thereof used in the art may be used in the present invention. Preferred examples are described in GB 1.400.898 or US 5.019.292. These clays include various multi-layer smectites or bentonites, also referred to as heated kaolin and montmolillonite. As known from the art, preferred smectite clays exhibit at least 50 meq cation exchange capacity per 100 grams of clay corresponding to layer charges 0.2 to 0.6. Also preferred are clays in the particle size range of 5-50 micrometers. Further preferred smectite clays are of the formula [Mg 3-x Li x ) Si 4-y Me III y O 10 (OH 2-z F z )] -(x + y) (x + y) M n + n [where when y = 0 or y = 0, Me III is Al, Fe or B; M n + is a monovalent (n = 1) or divalent (n = 2) metal ion selected from Na, K, Mg, Ca, Sr, for example. The value of (x + y) is the layer charge of the hectorite clay. Suitable hectorite clays for the detergent compositions of the present invention have a layer charge distribution such that at least 50% is in the range of 0.23 to 0.31. Preferred are hectorite clays of natural origin with a layer charge distribution such that at least 65% range from 0.23 to 0.31. Specific non-limiting examples of woven softening smectite clay minerals are as follows: Sodium montmorillonite: Brock ™, Volclay BC ™, Gelwhite GP ™, Thixo-Jel ™, Ben-A-gel Gel ™). Sodium hectorite: Veegum F ™ and Lapomite SP ™. Sodium saponite: Barasym NAS 100 ™. Calcium montmorillonite: Soft Clark ™, Gelwhite L ™, Imvite K ™, CSM-Clay ™ from Kymulos. Lithium hectorite: Barasym LIH 200 ™. The amount of softened clay used in the present invention varies depending on the type of laundry detergent and / or fabric protection composition. Generally, the lower limit may range from 0.1%, 3% or 4% to the upper limit of 50%, 25% or 15%. Detergent ingredients Laundry detergents and / or fabric protection compositions of the present invention should contain at least one additional detergent component. The specific properties of these additional components and the degree of incorporation thereof will vary depending on the physical form of the composition and the nature of the cleaning operation for the composition to be used. Laundry detergents and / or fabric protection compositions of the invention are preferably laundry detergents and / or fabric protections selected from extenders, cationic surfactants and / or mixtures thereof selected from cellulase, zeolites, sodium tripolyphosphate and / or laminated silicates. Further comprising the composition. Laundry detergents and / or textile care compositions according to the invention may be liquids, pastes, gels, bars, tablets, propellants, blowing agents, powders or granules. The granular composition may also be present in "dense" form and liquid composition or in "concentrated" form. The composition of the present invention may be formulated as a manual and washing machine detergent composition comprising, for example, a composition suitable for use in immersion and / or pretreatment of a dye addition composition and dyeing fabrics, for cleaning of added fabric softening compositions. When formulated as a composition suitable for use in a washing machine washing method, the compositions of the present invention are preferably surfactant systems or phosphate-based extenders, non-ionic, which may contain a mixture of anions, cations, nonions, zwitterions or surfactants. Both extender systems that may contain organic extenders such as phosphate-based inorganic zeolites, laminated silicates, citrate, and preferably organic polymeric compounds, bleaches, additional enzymes, foam inhibitors, dispersants, lime soap dispersants, fouling suspension And, may further contain one or more detergent components selected from anti-redeposition agents, corrosion inhibitors. Laundry compositions may also contain different softeners than the inorganic clays claimed in the present invention as additional detergent components. Such compositions containing mannanases and clays, when formulated as laundry detergent compositions, can provide fabric cleaning, stain removal, softening, color appearance. The compositions of the present invention can also be used as detergent addition products in solid or liquid form. Such additive products tend to supplement or increase the performance of conventional detergent compositions and may be added at any stage of the cleaning process. If necessary, the density of the laundry detergent composition herein is in the range of 400-1200 g / l, preferably 500-950 g / l of the composition measured at 20 ° C. The "dense" form of the composition herein is well reflected by density and by the amount of inorganic filler salt in terms of the composition, the inorganic filler salt is a common component of the detergent composition in powder form, and in conventional detergent compositions, the filler Salt is present in substantial amounts, typically 17-35% of the total composition. In the dense composition, the filler salt is present in an amount of no greater than 15% by weight of the total composition, preferably in an amount not exceeding 10% by weight, most preferably in an amount of no greater than 5% by weight. Inorganic filler salts as meant in the compositions are selected from alkali and alkaline earth metal salts of sulfates and chlorides. Preferred filler salts are sodium sulfate. The liquid detergent composition according to the invention may be present in "concentrated form", in which case the liquid detergent composition according to the invention will contain a small amount of water compared to conventional liquid detergents. Typically the water content of the concentrated liquid detergent is preferably less than 40% by weight, more preferably less than 30% by weight and most preferably less than 20% by weight of the detergent composition. Suitable detergent compounds for use herein are selected from the group consisting of the following compounds. Surfactant system Laundry detergents and / or textile care compositions according to the invention are characterized in that the surfactant is selected from nonionic and / or anionic and / or cationic and / or amphoteric and / or zwitterionic and / or semipolar surfactants. It may further comprise a surfactant system. Laundry detergents and / or fabric protection compositions of the invention will preferably further comprise cationic surfactants. The compositions further comprising cationic surfactants have been found to surprisingly provide improved cleaning and softening performance. Other surfactants are typically present in amounts of 0.1% to 60% by weight. More preferred incorporation levels are from 1% to 35% by weight, most preferably from 1% to 30% by weight of the laundry detergent and / or fabric protection composition according to the invention. The surfactant is preferably formulated to be compatible with the enzyme components present in the composition. In liquid or gel compositions, the surfactant is most preferably formulated to enhance or at least reduce the stability of the enzymes in such compositions. Polybutylene oxide condensates of polyethylene, polypropylene and alkyl phenols are suitable for use as nonionic surfactants in the surfactant systems of the present invention and preference is given to using polyethylene oxide condensates. Such compounds include condensation products of alkyl phenols having alkyl groups containing about 6 to about 14 carbon atoms, preferably about 8 to about 14 carbon atoms in a straight or branched chain configuration with an alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to about 2 to about 25 moles, more preferably about 3 to about 15 moles of ethylene oxide per mole of alkyl phenol. Commercially available nonionic surfactants of this type include lgepal ™ CO-630 (manufactured by GAF Corporation) and Triton ™ X-45, X-114, X-100 and X-102 (from Rohm & Haas Company). Such surfactants are commonly referred to as alkylphenol alkoxylates such as alkyl phenol ethoxylates. Condensation products of the first and second aliphatic alcohols with about 1 to about 25 moles of ethylene oxide are suitable for use as nonionic surfactants in the nonionic surfactant systems of the present invention. The alkyl chain of the aliphatic alcohol may be straight or branched, first or second alcohol and generally contains about 8 to about 22 carbon atoms. Condensation products of alcohols having alkyl groups containing about 8 to about 20 carbon atoms, more preferably about 10 to about 18 carbon atoms with about 2 to about 10 moles of ethylene oxide per mole of alcohol are preferred. About 2 to about 7 moles, most preferably 2 to 5 moles of ethylene oxide per mole of alcohol are present in the condensation product. Examples of commercially available nonionic surfactants of this type are both Terbitol ™ 15-S-9 (condensation products of C 11 -C 15 linear alcohols with 9 moles of ethylene oxide), tergitol ™ 24-L-6 NMW (condensation product with narrow molecular weight distribution of C 12 -C 14 primary alcohol and 6 moles of ethylene oxide); Neodol ™ 45-9 (condensation product of C 14 -C 15 linear alcohol with 9 moles of ethylene oxide) from Shell Chemical Company, Neodol ™ 23-3 (C 12 -C 13 linear alcohol and ethylene oxide) 3.0 moles of condensation product), Neodol ™ 45-7 (condensation product of C 14 -C 15 linear alcohol with 7 moles of ethylene oxide), neodol ™ 45-5 (C 14 -C 15 linear alcohol and ethylene oxide Condensation product with 5 moles); Kyro ™ EOB from Procter & Gamble Company (condensation product of 9 moles of ethylene oxide with C 13 -C 15 alcohol); And a Zhenst product, Genapol LA O 3 O or O 5 O (condensation products of C 12 -C 14 alcohols with 3 or 5 moles of ethylene oxide). The preferred range of HLB in such products is 8 to 11 and most preferably 8 to 10. Useful as nonionic surfactants of the surfactant systems of the invention are hydrophobic groups and polyglycosides containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms, such as polyglycosides, saccharide units. Alkylpolysaccharides having hydrophilic groups containing from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 (Llenado as of January 21, 1986). US Pat. No. 4,565,647. Any reducing saccharide containing 5 or 6 carbon atoms may be used, for example, glucose, galactose and galactosyl residues may be substituted with glucosyl residues (any hydrophobic group being 2-, 3-, To bind glucose at the 4-, etc. position, thus obtaining glucose or galactose as opposed to glucose or galactose). Internal saccharide bonds may be present, for example, between one position of additional saccharide units and the 2-, 3-, 4- and / or 6-positions of previous saccharide units. Preferred alkylpolyglycosides are of the formula R 2 O (C n H 2n O) t (glycosyl) x , wherein R 2 contains an alkyl group having from about 10 to about 18 carbon atoms, preferably from about 12 to about 14 carbon atoms. Is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl and mixtures thereof, n is 2 or 3, preferably 2, t is from 0 to about 10, preferably 0, and x Is about 1.3 to about 10, preferably about 1.3 to about 3, most preferably about 1.3 to about 2.7). Glycosyl is preferably derived from glucose. To prepare such compounds, alcohols or alkylpolyethoxy alcohols are first formed and then reacted with a glucose or glucose source to form glucosides (bonds at the 1-position). The further glycosyl units can then be bound between the 1-position and the previous glycosyl units 2-, 3-, 4- and / or 6-position, preferably mainly 2-position. Condensation products of ethylene oxide with hydrophobic bases formed by condensation of propylene oxide with propylene glycol are also suitable for use as further nonionic surfactant systems of the invention. Such hydrophobic sites preferably have a molecular weight of about 1500 to about 1800 and exhibit water insolubility. The addition of polyethylene moieties to these hydrophobic moieties tends to increase the water solubility of the entire molecule and about 50 weight of the total condensation product whose liquid properties correspond to polyoxyethylene content condensates of up to about 40 moles of ethylene oxide It remains below the point of%. Examples of compounds of this type include certain commercially available Flurafac ™ LF404 and Pluronic ™ surfactants (BASF). Also suitable for use as nonionic surfactants of the nonionic surfactant systems of the present invention are condensation products of products obtained from the reaction of ethylene oxide with propylene oxide and ethylene diamine. The hydrophobic moiety of this product consists of the reaction product of ethylenediamine and excess propylene oxide, and generally has a molecular weight of about 2500 to about 3000. The hydrophobic moiety is condensed with ethylene oxide such that the condensation product contains from about 40% to about 80% by weight polyoxyethylene and has a molecular weight of from about 5,000 to about 11,000. Examples of nonionic surfactants of this type include certain commercially available Tetronic ™ compounds (BASF). Preferred for use as nonionic surfactants of the surfactant systems of the invention are polyethylene oxide condensates of alkylphenols, condensation products of primary and secondary aliphatic alcohols with about 1 to about 25 moles of ethylene oxide, alkylpolysaccharides and Mixtures thereof. Most preferred are C 8 -C 14 alkyl phenol ethoxylates of ethoxy groups 3 to 15 and C 8 -C 18 alcohol ethoxylates (preferably average C 10 ) of ethoxy groups 2 to 10. Very preferred nonionic surfactants are represented by the formula Wherein R 1 is H, R 1 is C 1-4 hydrocarbyl, 2-hydroxy ethyl, 2-hydroxy propyl or mixtures thereof, R 2 is C 5-31 hydrocarbyl and Z is 3 Hydroxyl is a polyhydroxy fatty acid amide surfactant of polyhydroxyhydrocarbyl or an alkoxylated derivative thereof having a straight chain hydrocarbyl chain bonded directly to the chain. Preferably R 1 is methyl, R 2 is a straight chain C 11-15 alkyl or C 16-18 alkyl or alkenyl chain such as coconut alkyl or mixtures thereof, and Z is glucose, fructose, mal in a reductive amination reaction. Derived from reducing sugars such as tods, lactose. Suitable anionic surfactants used include C 8 -C 20 carboxylic acids sulfonated with gaseous SO 3 according to “The Journal of the American Oil Chemists Society”, 52 (1975), pp 323-329. That is, the linear alkyl benzene sulfonate and alkyl ester sulfonate surfactant containing the linear ester of fatty acids). Suitable starting materials include natural fatty substances derived from animal oil, palm oil and the like. Particularly preferred alkyl ester sulfonate surfactants for laundry use are Wherein R 3 is C 8 -C 20 hydrocarbyl, preferably alkyl or a combination thereof, R 4 is C 1 -C 6 hydrocarbyl, preferably alkyl or a combination thereof, M is an alkyl ester sulfonate and Alkyl ester sulfonate surfactants). Suitable salt forming cations include metals such as sodium, potassium and lithium, and substituted or unsubstituted ammonium cations such as monoethanolamine, diethanolamine and triethanolamine. Preferably R 3 is C 10 -C 16 alkyl and R 4 is methyl, ethyl or isopropyl. Particular preference is given to methyl ester sulfonates wherein R 3 is C 10 -C 16 alkyl. Other suitable anionic surfactants are of formula ROSO 3 M [where R is preferably an alkyl or hydroxyalkyl having a C 10 -C 24 hydrocarbyl, preferably a C 10 -C 20 alkyl component, more preferably C 12- C 18 alkyl or hydroxyalkyl, where M is H or a cation such as an alkali metal cation (eg sodium, potassium, lithium) or ammonium or substituted ammonium (eg methyl-, dimethyl- and trimethyl ammonium cation) And quaternary ammonium cations such as tetramethyl ammonium and dimethyl piperidium cations, and quaternary ammonium cations derived from alkylamines such as ethylamine, diethylamine, triethylamine and mixtures thereof, and the like. Alkyl sulfate surfactants. Typically alkyl chains of C 12 -C 16 are preferred at lower wash temperatures (eg below about 50 ° C.) and C 16 -C 18 alkyl chains are preferred at higher wash temperatures (eg above about 50 ° C.). Other anionic surfactants useful for detergent purposes may also be included in the cleaning compositions of the present invention. These include salts of soap (eg, sodium, potassium, ammonium, and substituted ammonium salts such as mono-, di- and triethanolamine salts), C 8 -C 22 first or second alkanesulfonates, C 8 -C 24 olefinsulfonates, for example sulfonated polycarboxylic acids, C 8 -C 24 alkylpolyglycol ethersulfates prepared by sulfonation of pyrroled products of alkaline earth metal citrate described in British Patent No. 1,082,179 10 mol or less of ethylene oxide); Alkyl glycerol sulfonates, fatty acyl glycerol sulfonates, fatty oleyl glycerol sulfates, alkyl phenol ethylene oxide ester sulfates, paraffin sulfonates, alkyl phosphates, isethionates such as acyl isethionates, N-acyl taurates, alkyl succinas Mate and sulfosuccinates, monoesters of sulfosuccinates (particularly saturated and unsaturated C 12 -C 18 monoesters) and diesters of sulfosuccinate (particularly saturated and unsaturated C 6 -C 12 diesters), Sulfates of alkylpolysaccharides such as acyl salcosinates, sulfates of alkylpolyglucosides (nonionic nonsulfated compounds described below), branched first alkyl sulfates and the formula RO (CH 2 CH 2 O) k -CH 2 COO Alkyl polys, such as compounds of —M +, where R is C 8 -C 22 alkyl, k is an integer from 1 to 10, and M is a soluble salt forming cation Ethoxy carboxylates. Also suitable are resinous acids and hydrogenated resinous acids, such as resinic acids and hydrogenated resinous acids present in or derived from rosin, hydrogenated rosin, and tall oil. Additional examples are described in "Surface Active Agents and Detergents" (Vol. I and II, Schwartz, Perry and Berch). These various surfactants are also generally described in U.S. Patent Nos. 3,929,678 to Laughlin, et al., Column 23, line 58 to column 29, line 23, incorporated herein by reference. Is granted. When included herein, laundry detergents and / or fabric care compositions typically contain from about 1% to about 40%, preferably from about 3% to about 20%, by weight of such anionic surfactants. do. Very preferred anionic surfactants are of the formula RO (A) m SO 3 M [where R is an unsubstituted C 10 -C 24 alkyl or hydroxyalkyl group having a C 10 -C 24 alkyl component, preferably C 12 -C 20 alkyl or hydroxyalkyl, more preferably C 12 -C 18 alkyl or hydroxyalkyl, A is an ethoxy or propoxy unit, m is at least 0, typically from about 0.5 to about 6, more Preferably from about 0.5 to about 3, M is H or a cation which may be, for example, a metal cation (eg sodium, potassium, lithium, calcium, magnesium, etc.), ammonium or a substituted ammonium cation] Or alkyl alkoxylated sulfate surfactants that are acids. Alkyl ethoxylated sulfates as well as alkyl propoxylated sulfates are contemplated herein. Specific examples of substituted ammonium cations include methyl-, dimethyl, trimethyl-ammonium cations and quaternary ammonium cations (e.g. tetramethyl-ammonium) and dimethyl pipedinium cations and alkyl amines (e.g. ethylamine, diethylamine, tri Cations derived from ethylamine), mixtures thereof, and the like. Exemplary surfactants include C 12 -C 18 alkyl polyethoxylate (1.0) sulfate (C 12 -C 18 E (1.0) M), C 12 -C 18 alkyl polyethoxylate (2.25) sulfate (C 12- C 18 E (2.25) M), C 12 -C 18 alkyl polyethoxylate (3.0) sulfate (C 12 -C 18 E (3.0) M) and C 12 -C 18 alkyl polyethoxylates (4.0) sulfate (C 12 -C 18 E (4.0) M), where M is selected from sodium and potassium for convenience. Laundry detergents and / or textile care compositions of the present invention may also include amphoteric, zwitterionic and semipolar surfactants, as well as nonionic and / or anionic surfactants, as well as those already described herein. Amphoteric surfactants are also suitable for use in the laundry detergents and / or fabric care compositions of the present invention. These surfactants can be broadly described as aliphatic derivatives of secondary or tertiary amines, or aliphatic derivatives of heterocyclic secondary and tertiary amines where the aliphatic radicals can be straight or branched. One of the aliphatic substituents has at least about 8 carbon atoms, typically about 8 to about 18 carbon atoms, and at least one contains an anionic accepting group such as carboxy, sulfonate, sulfate. See US Pat. No. 3,929,678, column 19, lines 18 to 35, issued to Laughlin et al. On December 30, 1975 for examples of amphoteric surfactants. When included herein, laundry detergents and / or fabric care compositions of the invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10%, by weight of such amphoteric surfactants. do. Zwitterionic surfactants are also suitable for use in laundry detergents and / or fabric care compositions. These surfactants can be broadly described as derivatives of secondary and tertiary amines, derivatives of heterocyclic secondary and tertiary amines, or derivatives of quaternary ammonium, quaternary phosphonium or tertiary sulfonium compounds. See US Pat. No. 3,929,678, column 19, line 38 to column 22, line 48, issued to Raulin et al., Dec. 30, 1975, for examples of zwitterionic surfactants. When included herein, laundry detergents and / or fabric care compositions of the invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such zwitterionic surfactants. do. Semipolar nonionic surfactants include water-soluble amine oxides containing one alkyl residue having from about 10 to about 18 carbon atoms and two residues selected from the group consisting of alkyl groups and hydroxyalkyl groups having from about 1 to about 3 carbon atoms; A water-soluble phosphine oxide containing one alkyl residue having about 10 to about 18 carbon atoms and two residues selected from the group consisting of alkyl groups and hydroxyalkyl groups having about 1 to about 3 carbon atoms; And a water-soluble sulfoxide containing one alkyl residue having about 10 to about 18 carbon atoms and one residue selected from the group consisting of alkyl and hydroxyalkyl residues having about 1 to about 3 carbon atoms. It is a certain class. Semipolar nonionic detergent surfactants are represented by the formula Wherein R 3 is an alkyl, hydroxyalkyl or alkyl phenyl group having from about 8 to about 22 carbon atoms or mixtures thereof; R 4 is an alkylene or hydroxyalkylene group having from about 2 to about 3 carbon atoms or mixtures thereof; x is 0 to about 3; R 5 is each an alkyl or hydroxyalkyl group having from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups) It includes. The R 5 groups can be attached to each other via, for example, oxygen or nitrogen atoms to form a ring structure. In particular, these amine oxide surfactants include C 10 -C 18 alkyl dimethyl amine oxides and C 8 -C 12 alkoxy ethyl dihydroxy ethyl amine oxides. When included herein, the cleaning compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such semipolar nonionic surfactant. Laundry detergents and / or textile care compositions of the present invention may further comprise a cosurfactant selected from the group of primary or tertiary amines. Primary amines suitable for use herein include those of the formula R 1 NH 2 , wherein R 1 is C 6 -C 12 , preferably C 6 -C 10 alkyl chain or R 4 X (CH 2 ) n (where X Is —O—, —C (O) NH— or —NH—, R 4 is a C 6 -C 12 alkyl chain and n is 1 to 5, preferably 3). . The R 1 alkyl chain may be straight or branched and may be linked with up to 12, preferably up to 5 ethylene oxide residues. Preferred amines according to the above formula are n-alkyl amines. Suitable amines for use herein may be selected from 1-hexylamine, 1-octylamine, 1-decylamine and laurylamine. Still other preferred primary amines include C 8 -C 10 oxypropylamine, octyloxypropylamine, 2-ethylhexyloxypropylamine, lauryl amido propylamine and amido propylamine. Tertiary amines suitable for use herein include those of the formula R 1 R 2 R 3 N, wherein R 1 and R 2 are C 1 -C 8 alkyl chains or R 3 is C 6 -C 12 , preferably C 6 -C 10 alkyl chain, or R 3 is R 4 X (CH 2 ) n , wherein X is —O—, —C (O) NH— Or -NH-, R 4 is C 4 -C 12 and n is 1 to 5, preferably 2 to 3). R 5 is H or C 1 -C 2 alkyl and x is 1 to 6; R 3 and R 4 may be straight or branched and the R 3 alkyl chain may be linked with up to 12, preferably up to 5 ethylene oxide residues. Preferred tertiary amines are of the formula R 1 R 2 R 3 N, wherein R 1 is a C 6 -C 12 alkyl chain and R 2 and R 3 are C 1 -C 3 alkyl or Wherein R 5 is H or CH 3 and x is 1 to 2. Also, the chemical formula Preferred are amidoamines wherein R 1 is C 6 -C 12 alkyl; n is 2 to 4, preferably 3; R 2 and R 3 are C 1 to C 4 . Most preferred amines of the present invention are 1-octylamine, 1-hexylamine, 1-decylamine, 1-dodecylamine, C 8 -C 10 oxypropylamine, N coco 1-3 diaminopropane, coconutalkyldimethylamine , Lauryldimethylamine, lauryl bis (hydroxyethyl) amine, coco bis (hydroxyethyl) amine, 2mol propoxylated lauryl amine, 2mol propoxylated octyl amine, lauryl amidopropyl dimethylamine, C 8 -C 10 amidopropyldimethylamine and C 10 amidopropyldimethylamine. Most preferred amines for use in the compositions herein are 1-hexylamine, 1-octylamine, 1-decylamine, 1-dodecylamine. Particular preference is given to n-dodecyldimethylamine and bishydroxyethylcoconutalkylamine and seven times ethoxylated oleylamine, lauryl amido propylamine and cocoamido propylamine. bleach Laundry detergents and / or textile care compositions of the invention may further comprise bleaches such as hydrogen peroxide, PB1, PB4 and percarbonates having a particle size of 400-800 μ. These bleach components may include one or more oxygen bleaches and one or more bleach activators, depending on the bleach selected. When present, the oxygen bleach compound may typically be present in an amount of about 1% to about 25%. The bleach component for use herein may be any of the bleaches useful in laundry detergents and / or fabric care compositions, including oxygen bleaches as well as other bleaches known in the art. Bleaches suitable for the present invention may be activated or deactivated bleaches. One class of oxygen bleaches that can be used includes percarboxylic acid bleaches and salts thereof. Suitable examples of this class of preparations include magnesium monoperoxyphthalate hexahydrate, magnesium salts of meta-chloro perbenzoic acid, 4-nonylamino-4-oxopoxybutyric acid and diperoxydodecanedioic acid. Such bleaches are described in US Pat. No. 4,483,781, US Patent 740,446, European Patent Application 0,133,354 and US Patent 4,412,934. Highly preferred bleaches also include the 6-nonylamino-6-oxperoxycaproic acid described in US Pat. No. 4,634,551. Another class of bleaches that may be used include halogen bleaches. For example, examples of hypohalite bleach include thiochloro isocyanuric acid and sodium and potassium dichloroisocyanurate and N-chloro and N-bromo alkanesulfonamides. Such materials are generally added at 0.5-10% by weight, preferably 1-5% by weight of the final product. Hydrogen peroxide release agents include bleach activators such as tetraacetylethylenediamine (TAED), nonanoyloxybenzenesulfonate (NOBS, described in US Pat. No. 4,412,934), 3,5-trimethylhexanoloxybenzenesulfonate ( ISONOBS, described in European Patent No. 120,591) or in combination with pentaacetylglucose (PAG) or phenolsulfonate esters of N-nonanoyl-6-aminocaproic acid (NACA-OBS, described in WO 94/28106) It can be used to form peracid as active bleach, which is superhydrolyzed to give an improved bleaching effect. Also suitable active agents are acylated citrate esters as described in pending European patent application 91870207.7 and pending US patent application 60 / 022,786 (The Procter & Gamble) (July 1996). 30) and 60 / 028,122, filed Oct. 15, 1996. Wherein R 1 is a C 7 -C 13 straight or branched saturated or unsaturated alkyl group, R 2 is a C 1 -C 8 straight or branched saturated or unsaturated alkyl group, and R 3 is a C 1 -C 4 straight chain Or a branched saturated or unsaturated alkyl group). Useful bleaching agents, including bleaching systems comprising peroxy acids and peroxy acids for use in laundry detergents and / or textile care compositions according to the invention and peroxy bleach compounds Applications USSN 08 / 136,626, PCT / US95 / 07823, WO 95/27772, WO 95/27773, WO 95/27774 and WO 95/27775. Hydrogen peroxide can also be present by adding an enzyme system (ie, enzymes and thus substrates) that can produce hydrogen peroxide early or during the washing and / or washing process. Such an enzyme system is described in European Patent Application 91212655.6, filed October 9, 1991. Metal-containing catalysts for use in bleach compositions include cobalt containing catalysts such as pentaamine acetate cobalt (III) salts and EPA 549 271; EPA 549 272; EPA 458 397; US 5,246,621; EPA 458 398; Manganese-containing catalysts such as those described in US 5,194,416 and US 5,114,611. Bleaching compositions comprising peroxy compounds, manganese-containing bleach catalysts and chelating agents are described in patent application no. Bleaches other than oxygen bleaches are also known in the art and may be used herein. Particularly preferred non-oxygen bleach types include photoactivated bleaches such as sulfonated zinc and / or aluminum phthalocyanine. These materials may be deposited on the substrate during the washing process. When irradiated with light in the presence of oxygen, such as hanging clothes for drying in the sun, sulfonated zinc phthalocyanine is activated and, as a result, the substrate is bleached. Preferred zinc phthalocyanine and photoactivating bleaching methods are described in US Pat. No. 4,033,718. Typically, laundry detergents and / or fabric care compositions may contain about 0.025% to about 1.25% by weight of sulfonated zinc phthalocyanine. Extender system Laundry detergents and / or fabric care compositions of the invention may further comprise extenders. Laundry detergents and / or fabric care compositions of the present invention may further comprise an extender, preferably selected from zeolites, sodium tripolyphosphates and / or laminated silicates. Surprisingly, it has been found that the composition further comprising an extender selected from zeolites, sodium tripolyphosphate and / or laminated silicates provides improved cleaning and softening performance. Any conventional extender system includes aluminosilicate materials, silicates, polycarboxylates, alkyl- or akenyl-succinic acid and fatty acid materials; Materials such as ethylenediamine tetraacetate, diethylene triamine pentamethylene acetate, metal ion promoters such as aminopolyphosphonates, especially ethylenediamine tetramethylene phosphonic acid and diethylene triamine pentamethylenephosphonic acid Suitable for use herein. Phosphate extenders can also be used herein. Suitable extenders may be inorganic ion exchange materials, typically inorganic hydrated aluminosilicate materials, more particularly hydrated synthetic zeolites such as hydrated zeolites A, X, B, HS or MAP. Another suitable inorganic extender material is laminated silicates such as SKS-6 (Hoechst). SKS-6 is a crystalline lamination silicate consisting of sodium silicate (Na 2 Si 2 O 5 ). Suitable polycarboxylates comprising one carboxy group include lactic acid, glycolic acid and ether derivatives thereof as described in Belgian Patents 831,368, 821,369 and 821,370. Polycarboxylates containing two carboxyl groups include water-soluble salts of succinic acid, malonic acid, (ethylenedioxy) diacetic acid, maleic acid, diglycolic acid, tartaric acid, tartronic acid and fumaric acid, as well as references in German Offen Ether carboxylates described in Genshlifts 2,446,686 and 2,446,687 and US Pat. No. 3,935,257 and sulfinyl carboxylates described in Belgian patent 840,623. In particular, polycarboxylates containing three carboxy groups are not only water soluble citrate, aconitate and citraconate, but also succinate derivatives such as carboxymethyloxysuccinate described in British Patent No. 1,379,241. , Oxypolys such as lactoxuccinates described in Dutch application 7205873 and 2-oxa-1,1,3-propane tricarboxylate described in British Patent No. 1,387,447. Carboxylate materials. Polycarboxylates containing four carboxy groups include oxydisuccinates described in British Patent No. 1,261,829; 1,1,2,2-ethane tetracarboxylate, 1,1,3,3-propane tetracarboxylate and 1,1,2,3-propane tetracarboxylate. Polycarboxylates containing sulfo substituents are described in the sulfosuccinate derivatives and documents described in British Patent Nos. 1,398,421 and 1,398,422 and US Patent No. 3,936,448 and in British Patent No. 1,082,179. Polycarboxylates containing phosphone substituents, while containing sulfonated pyrolyzed citrate, are described in British Patent No. 1,439,000. Alicyclic and heterocyclic polycarboxylates include cyclopentane-cis, cis, cis-tetracarboxylate, cyclopentadienide pentacarboxylate, 2,3,4,5-tetrahydro-furan-cis, cis, cis- Tetracarboxylate, 2,5-tetrahydro-furan-cis-dicarboxylate, 2,2,5,5-tetrahydrofuran-tetracarboxylate, 1,2,3,4,5,6-hexane-hexa Carboxylates and carboxymethyl derivatives of polyhydric alcohols such as sorbitol, mannitol and xylitol. Aromatic poly-carboxylates include the melic acid, pyromellitic acid and phthalic acid derivatives described in British Patent No. 1,425,343. Among these, preferred polycarboxylates are hydroxycarboxylates, more particularly citrate, containing up to 3 carboxy groups per molecule. Preferred extender systems for use in the compositions include water insoluble aluminosilicate extenders, such as zeolite A or a mixture of laminated silicates (SKS-6) and water soluble carboxylate chelating agents such as citric acid. Another preferred extender system includes a mixture of a water insoluble aluminosilicate extender such as zeolite A and a water soluble carboxylate chelating agent such as citric acid. Preferred extender systems for use in the liquid laundry detergents and / or fabric care compositions of the present invention are soaps and polycarboxylates. Still other extender materials that may form part of an extender system for use in granular compositions include inorganic materials such as alkali metal carbonates, bicarbonates, silicates, and organic materials such as organic phosphonates, Amino polyalkylene phosphonates and amino polycarboxylates. Another suitable water soluble organic salt is a homo- or co-polymeric acid or a salt thereof, wherein the polycarboxylic acid comprises two or more carboxyl radicals separated from each other by up to two carbon atoms. Polymers of this type are described in GB-A- 1,596,756. Examples of such salts are polyacrylates and maleic anhydrides of MW 2000 to 5000 and copolymers thereof, the molecular weights of which are from 20,000 to 70,000, in particular about 40,000. Detergent extender salts are usually included in amounts of 5% to 80% by weight, preferably 10% to 70% by weight, most typically 30% to 60% by weight of the composition. Conventional detergent enzymes Laundry detergents and / or fabric care compositions may further comprise one or more enzymes which provide cleaning performance, fabric protection and / or hygiene benefits in addition to the metase enzyme. Laundry detergent and fabric protection compositions of the invention will preferably further comprise cellulase. Surprisingly, the composition further comprising cellulase provides improved cleansing and softening ability. The enzymes include cellulase, hemicellase, peroxidase, protease, glucoamylase, amylase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratanase, reductase , Oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tanase, pentosanase, malanase, β-glucanase, arabinosidase, hyaluronidase, chondroitina Agent, laccase or a mixture thereof. Preferred combinations are laundry detergents and / or fabric protection compositions having a cocktail of commonly applicable enzymes such as proteases, amylases, lipases, cutases, and / or cellulase associated with one or more plant cell wall degrading enzymes. Suitable proteases are subtilsin (subtilisin BPN and BPN ') obtained from certain strains of B. subtilis and B. rickeniformis. Suitable proteases are Bacillus with maximum activity over a pH range 8-12, developed by Danish Novo Industries A / S (“Novo”) and marketed under the tradename ESPERASE R. Obtained from strains of. The preparation of these and similar enzymes is described in GB 1,243,784, Novo. Another suitable protease Novo's Alcala claim (ALCALASE) R, dura load (DURAZYM) R and Sabina claim (SAVINASE) R and Geest-Broca des (Gist-Brocades)'s barracks hydratase (MAXATASE) R, barracks knife ( MAXACAL) R , PROPERASE R and MAXAPEM R (protein engineered maksacal). In addition, proteolytic enzymes are described in modified bacterial serine proteases, for example in European Patent Application No. 87 303761.8 (especially pages 17, 24 and 98), filed April 28, 1987. Bacterial serine proteolytic enzymes as described herein (as referred to herein as “protease B”), and modified as described in European Patent Application No. 199,404 to Venegas, published October 29, 1986. Is referred to herein as “protease A.” Protease called “protease C” is suitable here, where lysine is arginine at position 27, tyrosine is valine at position 104, and at position 123. Serine is an asparagine, a variant of alkaline serine protease from Bacillus, with alanine replaced with threonine at position 274. Protease C is described in EP 9915958: 4 published May 16, 1991, corresponding to WO 91/06637. In particular, genetically modified variants of protease C are also included herein. Preferred proteases, designated “protease D”, are variants of carbonyl hydrolases having amino acid sequences that do not exist in nature and are disclosed in WO 95/10591 and US Ser. No. 08 / 322,677, filed October 13, 1994. A position equivalent to the +76 position in the carbonyl hydrolase according to the numbering of Bacillus amyloliquefaciens subtilisin, described in patent application “Bleaching Compositions Comprising Protease Enzymes” of C. Ghosh et al., Preferably +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197 At a position combined with one or more amino acid residue positions equivalent to those selected from the group consisting of +204, +206, +210, +216, +217, +218, +222, +260, +265 and / or +274 It is derived from precursor carbonyl hydrolases by substituting different amino acid residues with various amino acid residues. In addition, one or more residues: +33, +62, +67, +76, +100, +101, +103, +104, +107, +128, +129, +130, +132, +135, +156 In combination with, +158, +164, +166, +167, +170, +209, +215, +217, +218 and +222 to replace various amino acid residues replaced in the precursor enzyme corresponding to the +210 position Suitable variants of the carbonyl hydrolase of the protease described in WO 95/10591, having an amino acid sequence derived therefrom, wherein the numbered positions are from Bacillus amyloliquefaciens Naturally occurring subtilisin or another carbonyl hydrolase or subtilisin, for example Bacillus lentus subtilisin (US Patent Application No. 60 / 048,550, filed June 4, 1997) Corresponds to the equivalent amino acid residue in. Also suitable are the proteases described in patent applications EP 251 446 and WO 91/06637, the proteases BLAP R described in WO 91/02792 and variants thereof described in WO 95/23221. See also the Bacillus sp., Described in Novo WO 93/18140 A, a high pH protease from NCIMB 40338. Enzymatic detergents comprising proteases, one or more other enzymes and reversible protease inhibitors are described in WO 92/03529 to Novo. If desired, proteases with reduced absorption and increased hydrolysis can be used as described in WO 95/07791 by Procter & Gamble. Recombinant trypsin-based proteases suitable for detergents herein are described in WO 94/25583 to Novo. Another suitable protease is described in EP 516 200 to Unilever. The proteolytic enzyme is used in the laundry detergent and / or fabric protection composition of the present invention at 0.0001% to 2% by weight, preferably 0.001% to 0.2% by weight, more preferably 0.005% to 0.1% by weight of the composition. It is incorporated as a positive pure enzyme. Cellulase useful in the present invention includes both bacterial or fungal cellases. Preferably, they have a pH optimum of 5 to 12 and an inactivity of at least 50 CEVU / mg (cellulose viscosity units). Suitable cellulases are described in US Pat. No. 4,435,307 (Barbesgoard et al., J61078384, and Humicola insolens, Trichoderma, Thielavia and Sporrotrichum, respectively. It is described in the literature describing the fungal cellulase produced (WO 96/02653). EP 739 982 describes cellulase isolated from novel Bacillus species. Suitable cellulases are also described in GB-A-2.075.028, GB-A-2.095.275, DE-OS-2.247.832 and WO95 / 26398. An example of such cellulase is produced by a strain of Humicola insolence (Humicola grisea var. Thermoidea), in particular Humicola strain DSM 1800. Still other suitable cellulase include cellulase originating from Humicola insolens, having a molecular weight of about 50 KDa and an isoelectric point of 5.5 and containing 415 amino acids; Humicola insolens showing cellulase activity, about 43 kD endoglucanase derived from DSM 1800, and the preferred endoglucanase component is the amino acid sequence described in PCT Patent Application WO 91/17243. Has Suitable cellulases are also EGIII cellulases of Trichoderma longgibrachytum origin as described in WO94 / 21801, Genencor, published September 29, 1994. Particularly suitable cellulases are those that have color protection advantages. An example of such cellulase is the cellulase described in European Patent Application No. 91202879.2 filed Nov. 6, 1991 (Novo). Carezyme and Celluzyme (Novo Nordisk A / S) are particularly useful. Reference literature: WO 91/17244 and WO 91/21801. Still other cellulase suitable for fabric protection and / or cleaning properties are described in WO96 / 34092, WO96 / 17994 and WO95 / 24471. The cellulase is generally incorporated into the laundry detergent and / or fabric protection composition in an amount of 0.0001% to 2% pure enzyme by weight of the laundry detergent and / or fabric protection composition. Peroxidase enzymes are used in combination with phenolic substrates as a bleach enhancing molecule in combination with oxygen sources such as percarbonate, perborate, persulfate and hydrogen peroxide. These are used in the "bleach", ie in the wash solution, to prevent the transfer of dyes or pigments removed from the substrate during the washing process to another substrate. Peroxidase enzymes are known in the art and include, for example, horseradish peroxidase, ligninase and haloperoxidase (eg, chloro- and bromo-peroxidase). Peroxidase-containing laundry detergents and / or fabric protection compositions are described, for example, in PCT International Applications WO89 / 099813, WO89 / 09813, and European Patent Application EP 91202882.6, filed November 6, 1991. And EP 96870013.8, filed February 20, 1996. Also suitable are laccase enzymes. Reinforcing agents are generally included in amounts of 0.1% to 5% by weight of the total composition. Preferred enhancers are substituted penthiazine and phenoxasine 10-phenothiazinepropionic acid (PPT), 10-ethylphenothiazine-4-carboxylic acid (EPC), 10-phenoxazinepropionic acid (POP) and 10-methylphenoazine (WO94). / 12621) and substituted syringes (C 3 -C 5 substituted alkyl syringes) and phenols. Sodium percarbonate or sodium perborate is the preferred source of hydrogen peroxide. The peroxidase is generally incorporated into the laundry detergent and / or fabric protection composition in an amount of 0.0001% to 2% pure enzyme by weight of the laundry detergent and / or fabric protection composition. Another preferred enzyme that may be included in the laundry detergents and / or textile care compositions of the present invention includes lipases. Lipase enzymes suitable for detergent use include those produced by microorganisms of the Pseudomonas group (eg, Pseudomonas stutzeri ATCC 19.154), as described in British Patent No. 1,372,034. Suitable lipases include those that produce an immunologically positive cross-reaction with the antibody of lipase, produced by Pseudomonas fluorescent IAM 1057 microorganisms. Such lipases are trade name Lipase P "Amano" [manufactured by Amano Pharmaceutical Co. Ltd., Nagoya, Japan]. Another suitable commercial lipase is Amano-CES, manufactured by Toyo Jozo Co., Tagata. Chromobacter viscosum available from Japan, for example, Chromobacter viscosum var. Lipases of the origin of lipoliticom NRRLB 3673; Chromobacter biscosum lipases available from US Biochemical Corp., USA and Disoynth Co., The Netherlands, and lipases of Pseudomonas gladioli origin. Particularly suitable lipases are lipases such as M1 lipase R and Lipomax R (Gist-Brocadeces) and Lipolase R and Lipolase Ultra R (Novo) which have been found to be very effective when used in combination with the compositions of the present invention. . Also suitable are lipolytic enzymes described in references EP 258068, WO 92/05249 and WO 95/22615 by Novo Nordisk and WO 94/03578, WO 95/35381 and WO 96/00292 by Unilever. Also suitable are cutinases [EC 3.1.1.50], which can be regarded as lipases of a certain kind, ie lipases that do not require surfactant activation. Addition of cutinase to detergent compositions is described in WO-A-88 / 09367 (Genencor); WO 90/09446 to Plant Genetic System and WO 94/14963 and WO 94/14964 (Unilever). Lipases and / or cutinases are generally incorporated into laundry detergents and / or fabric protection compositions in amounts of 0.0001% to 2% by weight pure enzyme in laundry detergents and / or fabric protection compositions. Amylases (α and / or β) may be included to remove carbohydrate stains. WO94 / 02597, Novo Nordisk A / S, published February 3, 1994, describes cleaning compositions incorporating mutant amylases. Reference: WO95 / 10603, Novo Nordisk A / S, published April 20, 1995. Another known amylase for use in the cleaning composition includes both α- and β-amylases. α-amylases are known in the art and described in US Pat. Nos. 5,003,257, EP 252,666, WO / 91/00353, FR 2,676,456, EP 285,123, EP 525,610, EP 368,341 and British Patent Specification No. 1,296,839 (Novo )]. Another suitable amylase is the enhanced amylase and literature described in WO94 / 18314 published August 18, 1994 and WO96 / 05295, Genencor published February 22, 1996. WO95 / 10603, published April 1995, is an amylase variant with additional modifications to the direct parent marketed by Novo Nordisk A / S. Examples of commercial α-amylase products are Furenfect Ox Am R from Genencor and Teramyl R , Ban R , Fungamyl from Novo Nordisk A / S Denmark R and Duramyl R. WO 95/26397 discloses another suitable amylase, namely thermamil R in the temperature range of 25 ° C. to 55 ° C. and the pH value range of 8 to 10 as measured by Padevas R α-amylase activity assay. Α-amylase, characterized by having a specific activity of at least 25% higher than that of. Variations of this enzyme described in WO 96/23873 (Novo Nordisk) are suitable. Another amylose degrading enzyme with improved properties for the combination of activity and thermal stability and higher activity is described in WO95 / 35382. Amylose degrading enzyme is present in the laundry detergent and / or fabric protection composition of the present invention in an amount of 0.0001% to 2% by weight, preferably 0.00018% to 0.06% by weight, more preferably 0.00024% to 0.048% by weight of the composition. It is incorporated as a positive pure enzyme. The enzymes mentioned above may be of any suitable origin, for example of plant, animal, bacterial, fungal and yeast origin. In addition, the origin may be mesophilic or cryogenic (frozen, thermophilic, thermophilic, thermophilic, alkaline, eosinophil, halogenic, etc.). Purified or unpurified forms of these enzymes can be used. Recently, it is common practice to modify wild type enzymes through protein / genetic engineering techniques to optimize their performance efficiency in the cleaning compositions of the present invention. For example, modifications can be devised to increase the miscibility of enzymes to conventional handling components of such compositions. Modifications can also be devised to tailor the optimum pH of the enzyme modification, bleach or chelator stability, catalytic activity, and the like to suit a particular cleaning article. In particular, in the case of bleaching stability, the focus should be on oxidation sensitive amino acids and on surface charge for surfactant miscibility. The isoelectric point of such enzymes can be modified by substitution with slightly charged amino acids, for example, increasing the isoelectric point may help to improve the miscibility of the anionic surfactant. In addition, the stability of the enzyme can be enhanced by, for example, generating additional salt bridges or strengthening calcium binding sites to increase the stability of the chelating agent. Most cellulase has a separate binding region (CBD), so special attention should be paid to the cellulase. These regions can be altered to change the properties of these enzymes. The enzyme is generally incorporated into the laundry detergent and / or fabric protection composition in a pure enzyme in an amount of 0.0001% to 2% by weight of the laundry detergent and / or fabric protection composition. The enzyme may be added as a separate single component (prills, granules, stabilizing liquids, etc. containing one enzyme) or as a mixture of two or more enzymes (eg cogranules). Another suitable detergent component that may be added is the enzymatic oxidation scavenger described in pending European Patent Application No. 92870018.6, filed January 31, 1992. An example of such an enzyme oxidation scavenger is ethoxylated tetraethylene polyamine. In addition, the range of enzymatic substances and methods for their incorporation into synthetic detergent compositions can be found in WO 9307263 A and WO 9307260 A (Genencor International), WO 8908694 A (Novo) and US 3,553,139 (January 5, 1971) ( McCarty et al.). Enzymes are also described in US Pat. No. 4,101,457 (July 18, 1978) (Place) and US 4,507,219 (March 26, 1985) (Hughes). Enzyme materials useful in liquid detergent compositions and their incorporation into such compositions are described in US Pat. No. 4,261,868 (14 April 1981) (Hora et al.). Detergent enzymes can be stabilized by various techniques. Enzyme stabilization techniques are described and illustrated in US 3,600,319 (August 17, 1971) (Gedge et al.), EP 199,405 and EP 200,586 (October 29, 1986) (Venegas et al.). Enzyme stabilization systems are also described, for example, in U.S. 3,519,570. Useful Bacillus species, AC13, which provide proteases, xylanases and cellulases, are described in WO 9401532 A (Novo). Color protection and fabric protection benefits Techniques that provide some sort of color protection benefit may also be included. An example of such a technique is a metallo catalyst for color retention. Such metallo catalysts are described in pending European patent application 92870181.2. Dye fixatives; Polyolefin dispersions for preventing wrinkles; And improved moisture absorbents, fragrances and amino-functional polymers for color protection treatments and fragrance permanence [PCT / US97 / 16546] are also examples of color protection / fabric protection techniques, dated November 7, 1996 Filed in pending patent application 96870140.9. Fabric softeners may also be incorporated into laundry detergents and / or fabric care compositions in accordance with the present invention. These agents may be of inorganic or organic type. Organic fabric softeners include the water insoluble tertiary amines described in GB-A1 514 276 and EP-B0 011 340, and C 12 -C 14 quaternary ammonium salts and combinations thereof are described in EP Double long chain amides described in -B-0 026 527 and EP-B-0 026 528, and also described in EP-B-0 242 919. Another useful organic component of the fabric softening system includes the high molecular weight polyethylene oxide materials described in EP-A-0 299 575 and 0 313 146. Organic fabric softeners, such as water-insoluble tertiary amines or double long chain amide materials, are incorporated in amounts of 0.5% to 5% by weight, typically 1% to 3% by weight, while high molecular weight polyethylene oxide materials and water soluble cationic materials are 0.1 It is added in an amount of 2 wt% to 2 wt%, usually 0.15 wt% to 1.5 wt%. In some cases the material may conveniently be added as dry mixed particles or sprayed into another solid component of the composition as a melt, but generally the material is added to the spray dried portion of the composition. Chelating agents The laundry detergents and / or fabric care compositions herein may also optionally contain one or more iron and / or manganese chelating agents. Such chelating agents may be selected from the group consisting of all amino carboxylates, amino phosphonates, polyfunctional-substituted aromatic chelating agents and mixtures thereof as defined below. Without wishing to be bound by theory, it is believed that the benefit of these materials is due in part to their exceptional ability to remove iron or manganese ions from the wash liquid by forming water soluble chelates. Amino carboxylates useful as any chelating agent include ethylenediaminetetraacetate, N-hydroxyethylethylenediaminetriacetate, nitrilotriacetate, ethylenediamine tetrapropionate, triethylenetetraaminehexaacetate, diethylenetriaminepentaacetate and ethanol Diglycine, alkali metals thereof, ammonium and substituted ammonium salts and mixtures thereof. If at least low concentrations of total phosphorus are acceptable in the detergent composition, amino phosphate is also suitable for use as a chelating agent in the compositions of the present invention, which includes ethylenediaminetetrakis (methylenephosphonate) as DEQUEST. do. Preferably, these amino phosphonates do not contain alkyl or alkenyl groups having about 6 or more carbon atoms. Multifunctional-substituted aromatic chelating agents are also useful in the compositions. See US Pat. No. 3,812,044, issued to Connor et al. On May 21, 1974. Preferred compounds of this type in acid form are dihydroxydisulfobenzenes such as 1,2-dihydroxy-3,5-disulfobenzene. Preferred biodegradable chelating agents for use herein are ethylenediamine disuccinate (“EDDS”), in particular US Pat. No. 4,704,233 (November 3, 1987), Hartman and Perkins. Is the [S, S,] isomer described in []. The compositions may also contain water soluble methyl glycine diacetic acid (MGDA) salts as useful chelating or co-extending agents, for example with insoluble extenders such as zeolites, laminated silicates and the like. When used, these chelating agents may generally comprise from about 0.1% to about 15% by weight of the laundry detergent and / or fabric care composition. More preferably, when used, these chelating agents may comprise from about 0.1% to about 3.0% by weight of such a composition. Foam inhibitor Another optional ingredient is a foam inhibitor, eg, a silicone and silica-silicon mixture. Silica is commonly used in finely pulverized forms, such as silica aerogels and xerogels and various types of hydrophobic silicas, while silicones can typically be typified by alkylated polysiloxane materials. These materials may be incorporated into particles in which the foam inhibitor is advantageously water soluble or water dispersible and releasably incorporated into a substantially non-surfactant detergent impermeable carrier. In addition, the antifoam can be dissolved or dispersed in a liquid carrier and introduced by spraying on one or more other ingredients. Preferred silicone foam modifiers are described in US Pat. No. 3, 933 672, Bartolta et al. Another particularly useful foam inhibitor is the self-emulsifying silicone foam inhibitor described in German patent application DTOS 2 646 126 published April 28, 1977. An example of such a compound is the siloxane-glycol copolymer DC-544 (Dow Corning). Particularly preferred foam control agents are antifoam systems comprising a mixture of silicone oil and 2-alkyl-alkanols. Suitable 2-alkyl-alkanols are 2-butyl-octanol sold under the trade name Isofol 12 R. Such antifoam systems are described in pending European patent application N 92870174.7, filed November 10, 1992. Particularly preferred silicone foam control agents are described in pending European patent application 92201649.8. The composition may comprise a silicone / silica mixture in combination with fumed nonporous silica, for example Aerosil R. The foam inhibitors described above are usually used in amounts of 0.001% to 2% by weight, preferably 0.01% to 1% by weight of the composition. Etc Other ingredients used in laundry detergents and / or textile care compositions, such as anti-fouling agents, anti-fouling agents, optical brighteners, abrasives, fungicides, anti-tarnish agents, colorants and / or encapsulated or unencapsulated fragrances, may be used. Can be. Particularly suitable encapsulating materials are water soluble capsules consisting of a matrix of polysaccharides and polyhydroxy compounds as described in GB 1,464,616. Another suitable water soluble encapsulation material includes dextrins derived from ungelatinized starch acid-esters of substituted dicarboxylic acids, such as those described in US Pat. No. 3,455,838. These acid-ester dextrins are preferably made from starch such as lead corn, lead sugar cane, sago, tapioca and potatoes. Suitable examples of such encapsulating materials include N-Lok (National Starch). N-lock encapsulation material consists of modified corn starch and glucose. This starch is modified by adding monofunctional-substituted groups such as octenyl succinic anhydride. Suitable antideposition agents and contaminant suspension agents herein include cellulose derivatives such as methylcellulose, carboxymethylcellulose and hydroxyethylcellulose, and homo- or co-polymeric polycarboxylic acids or salts thereof. Polymers of this type include maleic anhydride-acrylic acid copolymers mentioned above as polyacrylates and extenders, as well as copolymers of maleic anhydride with ethylene, methylvinyl ether or methacrylic acid, wherein the maleic anhydride It constitutes at least 20 mol% of the silver copolymer. These materials are usually used in amounts of 0.5% to 10% by weight, more preferably 0.75% to 8% by weight, most preferably 1% to 6% by weight of the composition. Preferred optical brighteners are anionic in nature, for example disodium 4,4'-bis- (2-diethanolamino-4-anilino-s-triazin-6-ylamino) stilben-2: 2'- Disulfonate, disodium 4,4'-bis- (2-morpholino-4-anilino-s-triazin-6-ylamino) stilben-2: 2'-disulfonate, disodium 4 , 4'-bis- (2,4-dianilino-s-triazin-6-ylamino) stilben-2: 2'-disulfonate, monosodium 4 ', 4 "-bis- (2, 4-Dianilino-s-triazin-6-ylamino) stilben-2-sulfonate, disodium 4,4'-bis- (2-anilino-4- (N-methyl-N-2- Hydroxyethylamino) -s-triazin-6-ylamino) stilben-2,2'-disulfonate, disodium 4,4'-bis- (4-phenyl-2,1,3-triazole -2-yl) -stilbene-2,2'-disulfonate, disodium 4,4'-bis- (2-anilino-4- (1-methyl-2-hydroxyethylamino) -s- Triazine-6-ylamino) stilben-2,2'-disulfonate, sodium-2- (stilville-4 "-(naphtho-1 ', 2': 4,5) -1,2, 3 -Triazole-2 "-sulfonate and 4,4'-bis (2-sulphostyryl) biphenyl. Highly preferred varnishes are the particular varnishes described in EP 753 567. Another useful polymeric material is polyethylene glycol, especially those having a molecular weight of 1000 to 10000, more particularly 2000 to 8000, most preferably about 4000. They are used in amounts of 0.20% to 5% by weight, more preferably 0.25% to 2.5% by weight. These polymers and the aforementioned mono- or co-polymeric polycarboxylate salts are effective in maintaining whiteness, decomposing remnants of fabrics, and improving cleaning performance on clay and proteinaceous and oxidizable contaminants in the presence of transition metal impurities. to be. Antifouling agents useful in the compositions of the present invention are usually copolymers or terpolymers of terephthalic acid with ethylene glycol and / or propylene glycol units in various arrangements. Examples of such polymers are described in assigned US Pat. Nos. 4116885 and 4711730 and European Patent Application Publication No. 0 272 033. Particularly preferred polymers according to EP-A 0 272 033 are the formulas (CH 3 (PEG) 43 ) 0.75 (POH) 0.25 [(T-PO) 2.8 (T-PEG) 0.4 ] T (POH) 0.25 ((PEG) 43 CH 3 ) 0.75 where PEG is-(OC 2 H 4 ) O—, PO is (OC 3 H 6 O), and T is (pcOC 6 H 4 CO). Also very useful are modified polyesters as random copolymers of dimethyl terephthalate, dimethyl sulfoisophthalate, ethylene glycol and 1,2-propane diol, the terminal group consisting primarily of sulfobenzoate and secondary Consisting of mono esters of ethylene glycol and / or propane-diol. The aim is to obtain a polymer sewn at both ends by sulfobenzoate groups, wherein most of the polymer herein "primarily" may be end-sealed into sulfobenzoate groups. As the coalescence can be less fully sealed, their terminal groups can consist of monoesters of ethylene glycol and / or propane 1,2-diol, and can be made “secondarily” to these species. The polyester selected herein comprises about 46% dimethyl terephthalic acid, about 16% propane 1,2-diol, about 10% ethylene glycol, about 13% dimethyl sulfobenzoic acid and about 15% sulfoisophthalic acid. Wt% and its molecular weight is about 3,000. The polyesters and their preparation are described in detail in EPA 311 342. It is well known in the art that free chlorine in tap water rapidly deactivates enzymes contained in detergent compositions. Thus, using chlorine scavengers such as perborate, ammonium sulfate, sodium sulfite or polyethyleneimine at least 0.1% by weight of the total composition can improve the wash stability of the detergent enzyme in such formulations. Compositions comprising a chlorine scavenger are described in European Patent Application No. 92870018.6, filed January 31, 1992. Those made from alkoxylated polycarboxylates such as polyacrylates are useful herein to provide additional grease removal performance. Such materials are described in WO 91/08281 and PCT 90/01815, page 4, incorporated herein by reference. Chemically, these materials include polyacrylates with one ethoxy side chain per 7 to 8 acrylate units. The side chains are of the formula-(CH 2 CH 2 O) m (CH 2 ) n CH 3 , where m is 2-3 and n is 6-12. The side chains are ester-bonded to the polyacrylate “backbone” to provide a structure of the “comb” polymer type.The molecular weight can vary, but typically ranges from about 2000 to about 50,000. Such alkoxylated polys Carboxylate may comprise from about 0.05% to about 10% by weight of the composition. Dispersant Laundry detergents and / or fabric care compositions of the invention may also contain a dispersant. Suitable water soluble organic salts are homo- or co-polymeric acids or salts thereof, wherein the polycarboxylic acid comprises at least two carboxyl radicals separated from one another by up to two carbon atoms. Polymers of this type are described in GB-A-1,596,756. Examples of such salts are polyacrylates and maleic anhydrides and copolymers thereof having a MW of 2000 to 5000, the molecular weight of such copolymers being from 1,000 to 100,000. In particular, copolymers of acrylates and methacrylates such as 480N having a molecular weight of 4000 may be added to the laundry detergents and / or textile care compositions of the present invention in amounts of 0.5 to 20% by weight of the composition. The composition of the present invention may contain a lime soap colloid compound having a lime soap dispersing force (LSDP) of preferably 8 or less, preferably 7 or less, most preferably 6 or less, as defined below. The lime soap colloid compound is preferably present at 0% to 20% by weight. Numerical measurements of lime soap colloidal efficacy are described by HC Borghetti and Bergman in J. Am. Oil. Chem. Soc., Vol. 27, pp. 88-90 (1950)], is presented by lime soap dispersion (LSDP) measured using lime soap dispersant test. The lime soap dispersion test method is described in, for example, WN Linfield, Surfactant science Series, Vol. 7, No. 3; WN Greenfield, Tenside surf. det., Vol. 27, pp. 159-163 (1990); And WK Nagarajan, WF Masler, Cosmetics and Toiletries, Vol. 104, pp. 71-73 (1989) and are widely used by those skilled in the art. The LSDP is the% weight ratio of sodium oleate to dispersant required to disperse the lime soap deposit formed by 0.025 g of sodium oleate in 30 ml of water of the same hardness as 333 ppm CaCO 3 (Ca: Mg = 3: 2). Surfactants with good lime soap collating ability may include certain amine oxides, betaines, sulfobetaines, alkyl ethoxysulfates and ethoxylated alcohols. Illustrative surfactants having an LSDP of 8 or less for use according to the invention are C 16 -C 18 dimethyl amine oxides, C 12 -C 18 alkyl ethoxysulfates having an average degree of ethoxylation of 1 to 5, in particular ethoxylation of 3 C 12 -C 15 alkyl ethoxysulfate surfactant (LSDP = 4), and an average degree of ethoxylation, sold under the trade names Lutensol A012 and Lutensol A030 (BASF GmbH), respectively, is 12 (LSDP = 6) or 30 C 14 -C 15 ethoxylated alcohols. Suitable polymeric lime soap colloids for use herein include M.K. Nagarayan, M.F. Masler; Cosmetics and Toiletries, Vol. 104, pp. 71-73 (1989). Hydrophobic bleach such as 4- [N-octanoyl-6-aminohexanoyl] benzene sulfonate, 4- [N-nonanoyl-6-aminohexanoyl] benzene sulfonate, 4- [N-deca Nonayl-6-aminohexanoyl] benzene sulfonate and mixtures thereof, and nonanoyloxy benzene sulfonate with hydrophilic / hydrophobic bleach can also be used as lime soap colloid compounds. Dye Delivery Suppression Laundry detergents and / or fabric care compositions of the present invention may also include compounds for inhibiting dye transfer from one fabric to another of the dissolved and suspended dyes encountered during fabric laundry operations comprising colored fabrics. Can be. Polymeric dye transfer inhibitors Laundry detergents and / or fabric protection compositions according to the invention also contain from 0.001% to 10% by weight, preferably from 0.01% to 2%, more preferably from 0.05% to 1% by weight of a polymeric dye transfer inhibitor. Contains% Such polymeric dye transfer inhibitors are generally incorporated into laundry detergents and / or fabric protection compositions to inhibit dye transfer from colored fabrics to the washed fabrics. These polymers have the ability to combine or absorb washed fading dyes from the dyed fabric before the dye has the opportunity to attach to another product during washing. Particularly suitable polymeric dye transfer inhibitors are polyamine N-oxide polymers, copolymers of N-vinylpyrrolidone and N-vinylimidazole, polyvinylpyrrolidone polymers, polyvinyloxazolidone and polyvinylimidazole or Mixtures thereof. In addition, such polymers are added to enhance the performance of the enzymes according to the invention. a) polyamine N-oxide polymer Suitable polyamine N-oxide polymers for use are of the formula Wherein P is a polymerizable unit, to which an RNO group may be attached, or wherein the RNO group forms a blend of some or both polymerizable units. A is -O-, -S-, -N-; x is 0 or 1; R is an aliphatic, ethoxylated aliphatic, aromatic, heterocyclic or cycloaliphatic group or combinations thereof, to which an NO group may be attached, wherein the nitrogen of the NO group is part of these groups. The NO group is represented by the formula Wherein R 1 , R 2 and R 3 are aliphatic groups, aromatic, heterocyclic or cycloaliphatic groups or combinations thereof, and x and / or y and / or z are 0 or 1, wherein the nitrogen of the NO group is May be attached or form part of these groups). The N-O group can be part of the polymerizable unit (P) or can be attached to the polymeric backbone or a combination of both. Suitable polyamine N-oxides in which the N-O groups form part of the polymerizable units include polyamine N-oxides wherein R is selected from aliphatic, aromatic, cycloaliphatic or heterocyclic groups. One class of such polyamine N-oxides includes groups of polyamine N-oxides wherein the nitrogen of the N-O group forms part of the R-group. Preferred polyamine N-oxides are those in which R is a heterocyclic group such as pyridine, pyrrole, imidazole, pyrrolidine, piperidine, quinoline, acridine and derivatives thereof. Another class of polyamine N-oxides are polyamine N-oxide groups in which the nitrogen of the N-O group is attached to the R-group. Another suitable polyamine N-oxide is a polyamine oxide having N-O groups attached to polymerizable units. A preferred class of these polyamine N-oxides are polyamine N-oxides of formula (I) wherein R is an aromatic, heterocyclic or cycloaliphatic group and the nitrogen of the N-O functional group is part of said R group. Examples of these classes are heterocyclic compounds wherein R is a heterocyclic compound such as pyridine, pyrrole, imidazole and derivatives thereof. Another preferred class of polyamine N-oxides are polyamine oxides of formula (I) wherein R is an aromatic, heterocyclic or cycloaliphatic group and the nitrogen of the N-O functional group is attached to said R group. Examples of these classes are polyamine oxides in which the R group can be aromatic, such as phenyl. Any polymer backbone can be used as long as the amine oxide polymer formed is water soluble and has dye delivery inhibiting properties. Examples of suitable polymeric backbones are polyvinyl, polyalkylene, polyesters, polyethers, polyamides, polyimides, polyacrylates and mixtures thereof. The amine N-oxide polymers of the present invention typically have a ratio of amine to amine N-oxides of 10: 1 to 1: 1000000. However, the amount of amine oxide groups present in the polyamine oxide polymer can be varied by suitable copolymerization or by suitable N-oxidation degrees. Preferably, the ratio of amine to amine N-oxide is 2: 3 to 1: 1000000. More preferably, 1: 4 to 1: 1000000, most preferably 1: 7 to 1: 1000000. The polymers of the present invention include random or block copolymers, in which one type of monomer is amine N-oxide and the other type of monomer is or is not amine N-oxide. The pK a of the amine oxide units of the polyamine N-oxide is less than 10, preferably less than pK a 7, more preferably less than pK a 6. Polyamine oxides can be obtained with almost all polymerization reactions. As long as the material has the desired water solubility and dye suspension, the degree of polymerization is not critical. Typically, the average molecular weight falls in the range of 500 to 1000,000, preferably 1,000 to 50,000, more preferably 2,000 to 30,000 and most preferably 3,000 to 20,000. b) copolymers of N-vinylpyrrolidone and N-vinylimidazole The average molecular weight range of the N-vinylimidazole and N-vinylpyrrolidone polymers used in the present invention is 5,000 to 1,000,000, preferably 5,000 to 200,000. Very preferred polymers for use in the detergent compositions according to the invention are selected from N-vinylimidazole N-vinylpyrrolidone copolymers, wherein the average molecular weight range of the polymer is from 5,000 to 50,000, more preferably from 8,000 to 30,000, most preferably 10,000 to 20,000. Average molecular weight ranges are described in Barth H.G and Mays J.W .; It is measured by the light scattering method described in Chemical Analysis, Vol. 113, "Modern Methods of Polymer Characterization". The highly preferred N-vinylimidazole N-vinylpyrrolidone copolymer has an average molecular weight range of 5,000 to 50,000, more preferably 8,000 to 30,000 and most preferably 10,000 to 20,000. N-vinylimidazole N-vinylpyrrolidone copolymers characterized by having the above average molecular weight range provide excellent dye transfer inhibition properties without adversely affecting the cleaning performance of detergent compositions prepared using the same. . The N-vinylimidazole N-vinylpyrrolidone copolymers of the present invention have an N-vinylimidazole to N-vinylpyrrolidone of 1 to 0.2, more preferably 0.8 to 0.3, most preferably 0.6 to 0.4. Have a molar ratio of money. c) polyvinylpyrrolidone Laundry detergents and / or fabric care compositions of the invention also have an average molecular weight of about 2,500 to about 400,000, preferably about 5,000 to about 200,000, more preferably about 5,000 to about 50,000 and most preferably about 5,000 to about Polyvinylpyrrolidone (“PVP”) of 15,000 can be used. Suitable polyvinylpyrrolidones include the trade names PVP K-15 (viscosity molecular weight 10,000), PVP K-30 (average molecular weight 40,000), PVP K-60 (average molecular weight 160,000) and PVP K-90 (average molecular weight 360,000) [manufacturer: ISP Cooperation, New York, NY and Montreal, Canada. Still other suitable polyvinylpyrrolidones include Sokalan HP 165 and Sokalan HP 12 [BASF Cooperation], which are polyvinylpyrrolidones known to those skilled in the detergent industry. EP-A- 262,897 and EP-A-256,696]. d) polyvinyloxazolidone Laundry detergents and / or fabric care compositions of the invention may also use polyvinyloxazolidone as a polymeric dye transfer inhibitor. The average molecular weight of the polyvinyloxazolidone is about 2,500 to about 400,000, preferably about 5,000 to about 200,000, more preferably about 5,000 to about 50,000 and most preferably about 5,000 to about 15,000. e) polyvinylimidazole Laundry detergents and / or fabric care compositions of the invention may also use polyvinylimidazole as a polymeric dye transfer inhibitor. The average molecular weight of the polyvinylimidazole is about 2,500 to about 400,000, preferably about 5,000 to about 200,000, more preferably about 5,000 to about 50,000 and most preferably about 5,000 to about 15,000. f) cross-linked polymers Cross-linked polymers are polymers whose main chains are interconnected to a certain degree, and these cross-links may have chemical or physical properties with active groups on the main chain or side chains if possible, and cross-linked polymers are described in [see: Journal of Polymer Science, Vol. 22, pp. 1035-1039. In one embodiment, the cross-linked polymer is prepared in such a way as to form a three dimensional rigid structure, which can trap the dye in the pores formed by the three dimensional structure. In another embodiment, the cross-linked polymer captures the dye by swelling. Such cross-linked polymers are described in pending patent application 94870213.9. Washing method The compositions of the present invention can be used in essentially any cleaning or cleaning method, including methods of having a cleaning step in which dipping, pretreatment and separate cleaning aid compositions can be added. The methods described herein include contacting the fabric with the wash liquor in the conventional manner and in the manner illustrated below. The method of the invention is carried out during the washing process for convenience. The cleaning method is preferably carried out at 5 ° C to 95 ° C, in particular at 10 ° C to 60 ° C. The pH of the treatment liquid is preferably 7 to 12. The following examples are intended to illustrate the composition of the invention, but not necessarily to limit or otherwise limit the scope of the invention. In laundry detergents and / or fabric care compositions, the enzyme concentration is expressed as pure enzyme relative to the total composition weight, and unless otherwise specified, the detergent component is expressed as the weight of the total composition. The presence of components abbreviated herein has the following meanings: LAS: Sodium Linear C 11-13 Alkyl Benzene Sulfonate TAS: Sodium Tallow Alkyl Sulfate CxyAS: Sodium C 1X -C 1y Alkyl Sulfate CxySAS: Sodium C 1x -C 1y Secondary (2,3) Alkyl Sulfate CxyEz: C 1x -C 1y predominant linear primary alcohols condensed using an average zmol ethylene oxide CxyEzS: C 1x -C 1y sodium alkyl sulfates condensed using average zmol ethylene oxide QAS: R 2 is a C 12 -C 14 R 2 N + (CH 3) 2 (C 2 H 4 OH) QAS 1: R 2 is a C 8 -C 11 R 2 N + (CH 3) 2 (C 2 H 4 OH) APA: C 8 -C 10 Amido Propyl Dimethyl Amine Soap: Sodium linear alkyl carboxylate derived from 80/20 mixture of tallow and coconut fatty acids Nonionic: C 13 -C 15 mixed ethoxylated / propoxylated fatty alcohols with an average ethoxylation of 3.8 and an average propoxylation of 4.5 Neodol 45 to 13: C 14 -C 15 linear primary alcohol ethoxylate [Shell Chemical CO.] STS: Sodium Toluene Sulfonate CFAA: C 12 -C 14 Alkyl N-methyl Glucamide TFAA: C 16 -C 18 alkyl N-methyl glucamide TPKFA: C 12 -C 14 Total Top Cleaved Fatty Acids Silicate: amorphous sodium silicate (SiO 2 : Na 2 O ratio = 1.6 to 3.2) Metasilicate: Sodium metasilicate (SiO 2 : Na 2 O ratio = 1.0) Zeolite A: Hydrated sodium aluminosilicate of formula Na 12 (A 1 O 2 SiO 2 ) 12 · 27H 2 O with a main particle size of 0.1 to 10 μm (weight based on anhydride) Na-SKS-6: Crystalline Laminated Silicate of Chemical Formula δ-Na 2 Si 2 O 5 Citrate: 86.4% active trisodium citrate dihydrate with a particle size distribution of 425-850 μm Citric Acid: Citric Acid Anhydrous Borate: Sodium Borate Carbonate: Anhydrous sodium carbonate with a particle size of 200 to 900 μm Bicarbonate: Anhydrous sodium bicarbonate with a particle size distribution of 400 to 1200 μm Sulfate: Anhydrous Sodium Sulfate Mg sulfate: anhydrous magnesium sulfate STPP: Sodium Tripolyphosphate TSPP: tetrasodium pyrophosphate MA / AA: random copolymer of 4: 1 acrylate / maleate having an average molecular weight of about 70,000 to 80,000 MA / AA 1: random copolymer of 6: 4 acrylate / maleate having an average molecular weight of about 10,000 AA: sodium polyacrylate polymer having an average molecular weight of 4,500 PA30: polyacrylic acid with an average molecular weight of about 4,500 to 8,000 480N: random polymer of 7: 3 acrylate / methacrylate having an average molecular weight of about 3,500 Polygel / Carbopol: High Molecular Weight Crosslinked Polyacrylate PB1: Anhydrous sodium perborate monohydrate of formula NaBO 2 .H 2 O 2 PB4: formula NaBO 2 .3H 2 OH 2 O 2 with a boronic acid sodium trihydrate Percarbonate: anhydrous sodium percarbonate of formula 2Na 2 CO 3 .3H 2 O 2 NaDCC: Sodium Dichloroisocyanurate TAED: tetraacetylethylenediamine NOBS: nonanoyloxybenzene sulfonate in the form of sodium salt NACA-OBS: (6-nonamidocaproyl) oxybenzene sulfonate DTPA: diethylene triamine pentaacetic acid HEDP: 1,1-hydroxyethane diphosphonic acid DETPMP: Diethyltriamine penta (methylene) phosphonate sold under the tradename Dequest 2060 manufactured by Monsanto. EDDS: ethylenediamine-N, N'-disuccinic acid in the sodium salt form, (S, S) isomer MnTACN: manganese 1,4,7-trimethyl-1,4,7-triazacyclononane Photoactivated Bleach: Sulfonated Zinc Phthalocyanine Encapsulated in Dextrin Soluble Polymer Photoactivated Bleach 1: Sulfonated Alumino Phthalocyanine Encapsulated in Dextrin Soluble Polymer PAAC: pentaamine acetate cobalt (III) salt Paraffin: Paraffin oil sold under the trade name Winog 70 [manufactured by Winter Shall]. NaBz: Sodium Benzoate BzP: Benzoyl Peroxide Encounter: Bacillus agar de Herrens, Encounter from NCIMB 40482 Proteases: proteases and literatures sold under the trade names Savinase, Alcalase, Durazim (Novo Nordisk A / S) and marketed under the trade names Maksacal, Maksafem [Gist-Brocades], see patent WO91 / 06637 and / or WO95 / 10591 and / or EP 251 446 Amylase: Commercially available under the trade names Purafact Ox Am R [Genencor], as described in WO 94/18314, WO96 / 05295, and under the trade names Termamil R , Fernamil R and Duramil R [Novo Nordisk A / Amylose degrading enzymes sold under S] and the amylose degrading enzymes described in WO95 / 26397. Lipase: Lipidase, marketed under the trade name Lipolase, Lipolase Ultra, manufactured by Novo Nordisk A / S, and marketed under the trade name Lipomax, manufactured by Gist-Brocades. Cellulase: Cellulose degrading enzyme sold under the trade names Carezyme, Cellulzyme and / or Endolase from Novo Nordisk A / S. Clay: smectite clay or bentonite clay CMC Sodium Carboxymethyl Cellulose PVP: polyvinyl polymer with an average molecular weight of 60,000 PVNO: polyvinylpyridine-N-oxide with an average molecular weight of 50,000 PVPVI: Copolymer of vinylimidazole and vinylpyrrolidone with an average molecular weight of 20,000 Brightener 1: Disodium 4,4'-bis (2-sulfostyryl) biphenyl Brightener 2: Disodium 4,4'-bis (4-anilino-6-morpholino-1,3,5-triazin-2-yl) stilbene-2: 2'-disulfonate Silicone Antifoam: Polydimethylsiloxane Foam Modifier Using Siloxoxyalkylene Copolymers as Dispersants with a Ratio of Foam Modifier to Dispersant 10: 1 to 100: 1 Antifoam: 12% silicone / silica in granule form, 18% stearyl alcohol, 70% starch Whitening agents: Aqueous monostyrene latex mixtures sold under the trade name Lytron 621 [BASF Aktiengesellshaft]. SRP 1: Anionic end-sealed polyester SRP 2: diethoxylated poly (1,2-propylene terephthalate) short block polymer QEA: bis ((C 2 H 5 O) (C 2 H 4 O) n ) (CH 3 ) -N + -C 6 H 12 -N + -(CH 3 ) Bis ((C 2 H 5 0)-(C 2 H 4 0)) n (where n is 20 to 30) PEI: Polyethylenimine with an average molecular weight of 1800 and an average degree of ethoxylation of 7 ethyleneoxy residues per nitrogen SCS: Sodium Cumene Sulfonate HMWPEO: high molecular weight polyethylene oxide PEGx: polyethylene glycol of x molecular weight PEO: polyethylene oxide with an average molecular weight of 5,000 TEPAE: Tetraethylenepentaamine ethoxylate Example 1 The following detergent compositions are prepared in accordance with the present invention. IⅡⅢ Swelling powder Zeolite A13.013.015.0 Sulfate-3.0- LAS3.03.03.0 QAS-1.51.5 DETPMP0.40.20.4 EDDS-0.40.2 CMC0.40.40.4 MA / AA4.02.02.0 Aggregate LAS5.05.05.0 TAS2.01.01.0 Silicate3.02.04.0 Zeolite A8.08.08.0 Carbonate7.04.04.0 Spray on air freshener0.30.30.3 C45E72.02.02.0 C25E32.0-- Dry additives Citrate3.0-2.0 Bicarbonate-3.0- Carbonate8.015.010.0 TAED6.02.05.0 PB19.07.010.0 PEO--0.2 Bentonite clay10.010.010.0 Met0.0010.0010.02 Protease0.030.030.03 Lipase0.0080.0080.008 Cellulase0.0010.0010.001 Amylase0.010.010.01 Silicone antifoam5.05.05.0 Sulfate-3.0- Density (g / ℓ)850850850 Miscellaneous goods and traces100% less than Example 2 The following liquid detergent compositions are prepared according to the invention (amounts are given in parts by weight and enzymes are expressed as pure enzymes). IⅡⅢⅣ LAS25.0--- C25AS-13.016.013.0 C25E3S-2.02.04.0 C25E7--4.04.0 TFAA-6.06.06.0 APA3.01.02.0- TPKFA-14.011.011.0 Citric acid1.01.01.01.0 Dodecenyl / tetradecenyl succinic acid15.0--- Rapeseed Fatty Acid1.0-3.5- ethanol7.02.03.02.0 1,2-propanediol6.08.010.013.0 Monoethanolamine--9.09.0 TEPAE--0.40.3 DETPMP2.01.21.0- Met0.0010.0020.020.001 Protease0.080.020.010.02 Lipase--0.0030.003 Amylase0.0040.010.010.01 Cellulase--0.0040.003 SRP 2--0.20.1 Boric acid1.01.52.52.5 Bentonite clay4.05.04.04.0 Brightener 10.10.20.3- Foam inhibitor0.4--- Bleach0.80.7-- NaOH miscellaneous goods and water below pH8.07.58.08.2 Example 3 The following granular fabric detergent composition is provided according to the present invention which provides a "softening through washing" performance. IⅡ C45AS-10.0 LAS7.6- C68AS1.3- C45E74.0- C23E3-5.0 Coco-alkyl-dimethyl hydroxy-ethyl ammonium chloride1.41.0 Citrate5.03.0 Na-SKS-6-11.0 Zeolite A15.015.0 MA / AA4.04.0 DETPMP0.40.4 PB115.0- Percarbonate-15.0 TAED5.05.0 Smectite clay10.010.0 HMWPEO-0.1 Met0.0010.02 Protease0.020.01 Lipase0.020.01 Amylase0.030.005 Cellulase0.001- Silicate3.05.0 Carbonate10.010.0 Foam inhibitor1.04.0 CMC0.20.1 Miscellaneous goods and traces100% less than Example 4 The following laundry stick detergent composition is prepared according to the present invention (amounts are given in parts by weight and enzymes are expressed as pure enzymes). IⅡⅢⅣⅤⅢⅣⅤ LAS--19.015.021.06.758.8- C28AS26.013.5---15.7511.222.5 Na laurate2.59.0------ Zeolite A2.01.25---1.251.251.25 Carbonate20.03.013.08.010.015.013.08.0 Ca carbonate27.539.031.0--36.0-36.0 Sulfate5.05.03.05.03.0--5.0 TSPP5.0----5.02.5- STPP5.015.010.0--7.08.010.0 Bentonite clay4.010.04.04.05.04.04.04.0 DETPMP-0.70.6-0.60.70.70.7 CMC-1.01.01.01.0--1.0 talc--10.011.010.0--- Silicate--4.05.03.0--- PVNO0.020.03-0.01-0.02-- MA / AA0.41.0--0.20.40.50.4 SRP 10.30.30.30.30.30.30.30.3 Met0.0010.0010.020.0010.020.030.010.001 Amylase--0.01---0.002- Protease-0.004-0.0030.003--0.003 Lipase-0.002-0.002---- Cellulase-0.0003--0.00030.0002-- PEO-0.2-0.20.3--0.3 air freshener1.00.50.30.20.4--0.4 Mg Sulfate--3.03.03.0--- Polish0.150.10.15----0.1 Photoactivated Bleach (ppm)-15.015.015.015.0--15.0 <110> The Procter & Gamble Company <120> Detergent compositions comprising a mannanase and a clay <130> 5-1998-062118-8 <150> EP 97870120.9 <151> 1997-08-14 <160> 6 <170> KOPATIN 1.5 <210> 1 <211> 1407 <212> DNA <213> Bacillus sp. <220> <221> CDS <222> (1) .. (1482) <223> nucleic acid, single, linear <400> 1 atgaaaaaaa agttatcaca gatttatcat ttaattattt gcacacttat aataagtgtg 60 ggaataatgg ggattacaac gtccccatca gcagcaagta caggctttta tgttgatggc 120 aatacgttat atgacgcaaa tgggcagcca tttgtcatga gaggtattaa ccatggacat 180 gcttggtata aagacaccgc ttcaacagct attcctgcca ttgcagagca aggcgccaac 240 acgattcgta ttgttttatc agatggcggt caatgggaaa aagacgacat tgacaccatt 300 cgtgaagtca ttgagcttgc ggagcaaaat aaaatggtgg ctgtcgttga agttcatgat 360 gccacgggtc gcgattcgcg cagtgattta aatcgagccg ttgattattg gatagaaatg 420 aaagatgcgc ttatcggtaa agaagatacg gttattatta acattgcaaa cgagtggtat 480 gggagttggg atggctcagc ttgggccgat ggctatattg atgtcattcc gaagcttcgc 540 gatgccggct taacacacac cttaatggtt gatgcagcag gatgggggca atatccgcaa 600 tctattcatg attacggaca agatgtgttt aatgcagatc cgttaaaaaa tacgatgttc 660 tccatccata tgtatgagta tgctggtggt gatgctaaca ctgttagatc aaatattgat 720 agagtcatag atcaagacct tgctctcgta ataggtgaat tcggtcatag acatactgat 780 ggtgatgttg atgaagatac aatccttagt tattctgaag aaactggcac agggtggctc 840 gcttggtctt ggaaaggcaa cagtaccgaa tgggactatt tagacctttc agaagactgg 900 gctggtcaac atttaactga ttgggggaat agaattgtcc acggggccga tggcttacag 960 gaaacctcca aaccatccac cgtatttaca gatgataacg gtggtcaccc tgaaccgcca 1020 actgctacta ccttgtatga ctttgaagga agcacacaag ggtggcatgg aagcaacgtg 1080 accggtggcc cttggtccgt aacagaatgg ggtgcttcag gtaactactc tttaaaagcc 1140 gatgtaaatt taacctcaaa ttcttcacat gaactgtata gtgaacaaag tcgtaatcta 1200 cacggatact ctcagctcaa cgcaaccgtt cgccatgcca attggggaaa tcccggtaat 1260 ggcatgaatg caagacttta cgtgaaaacg ggctctgatt atacatggca tagcggtcct 1320 tttacacgta tcaatagctc caactcagga acaacgttat cttttgattt aaacaacatc 1380 gaaaatagtc atcatgttag ggaaataggc gtgcaatttt cagcggcaga taatagcagt 1440 ggtcaaactg ctctatacgt tgataacgtt actttaagat ag 1482 <210> 2 <211> 493 <212> PRT <213> Bacillus sp. <223> amino acid, linear <400> 2 Met Lys Lys Lys Leu Ser Gln Ile Tyr His Leu Ile Ile Cys Thr Leu 1 5 10 15 Ile Ile Ser Val Gly Ile Met Gly Ile Thr Thr Ser Pro Ser Ala Ala 20 25 30 Ser Thr Gly Phe Tyr Val Asp Gly Asn Thr Leu Tyr Asp Ala Asn Gly 35 40 45 Gln Pro Phe Val Met Arg Gly Ile Asn His Gly His Ala Trp Tyr Lys 50 55 60 Asp Thr Ala Ser Thr Ala Ile Pro Ala Ile Ala Glu Gln Gly Ala Asn 65 70 75 80 Thr Ile Arg Ile Val Leu Ser Asp Gly Gly Gln Trp Glu Lys Asp Asp 85 90 95 Ile Asp Thr Ile Arg Glu Val Ile Glu Leu Ala Glu Gln Asn Lys Met 100 105 110 Val Ala Val Val Glu Val His Asp Ala Thr Gly Arg Asp Ser Arg Ser 115 120 125 Asp Leu Asn Arg Ala Val Asp Tyr Trp Ile Glu Met Lys Asp Ala Leu 130 135 140 Ile Gly Lys Glu Asp Thr Val Ile Ile Asn Ile Ala Asn Glu Trp Tyr 145 150 155 160 Gly Ser Trp Asp Gly Ser Ala Trp Ala Asp Gly Tyr Ile Asp Val Ile 165 170 175 Pro Lys Leu Arg Asp Ala Gly Leu Thr His Thr Leu Met Val Asp Ala 180 185 190 Ala Gly Trp Gly Gln Tyr Pro Gln Ser Ile His Asp Tyr Gly Gln Asp 195 200 205 Val Phe Asn Ala Asp Pro Leu Lys Asn Thr Met Phe Ser Ile His Met 210 215 220 Tyr Glu Tyr Ala Gly Gly Asp Ala Asn Thr Val Arg Ser Asn Ile Asp 225 230 235 240 Arg Val Ile Asp Gln Asp Leu Ala Leu Val Ile Gly Glu Phe Gly His 245 250 255 Arg His Thr Asp Gly Asp Val Asp Glu Asp Thr Ile Leu Ser Tyr Ser 260 265 270 Glu Glu Thr Gly Thr Gly Trp Leu Ala Trp Ser Trp Lys Gly Asn Ser 275 280 285 Thr Glu Trp Asp Tyr Leu Asp Leu Ser Glu Asp Trp Ala Gly Gln His 290 295 300 Leu Thr Asp Trp Gly Asn Arg Ile Val His Gly Ala Asp Gly Leu Gln 305 310 315 320 Glu Thr Ser Lys Pro Ser Thr Val Phe Thr Asp Asp Asn Gly Gly His 325 330 335 Pro Glu Pro Pro Thr Ala Thr Thr Leu Tyr Asp Phe Glu Gly Ser Thr 340 345 350 Gln Gly Trp His Gly Ser Asn Val Thr Gly Gly Pro Trp Ser Val Thr 355 360 365 Glu Trp Gly Ala Ser Gly Asn Tyr Ser Leu Lys Ala Asp Val Asn Leu 370 375 380 Thr Ser Asn Ser Ser His Glu Leu Tyr Ser Glu Gln Ser Arg Asn Leu 385 390 395 400 His Gly Tyr Ser Gln Leu Asn Ala Thr Val Arg His Ala Asn Trp Gly 405 410 415 Asn Pro Gly Asn Gly Met Asn Ala Arg Leu Tyr Val Lys Thr Gly Ser 420 425 430 Asp Tyr Thr Trp His Ser Gly Pro Phe Thr Arg Ile Asn Ser Ser Asn 435 440 445 Ser Gly Thr Thr Leu Ser Phe Asp Leu Asn Asn Ile Glu Asn Ser His 450 455 460 His Val Arg Glu Ile Gly Val Gln Phe Ser Ala Ala Asp Asn Ser Ser 465 470 475 480 Gly Gln Thr Ala Leu Tyr Val Asp Asn Val Thr Leu Arg 485 490 <210> 3 <211> 1407 <212> DNA <213> Bacillus sp. <223> nucleic acid, single, linear <400> 3 atgaaaaaaa agttatcaca gatttatcat ttaattattt gcacacttat aataagtgtg 60 ggaataatgg ggattacaac gtccccatca gcagcaagta caggctttta tgttgatggc 120 aatacgttat atgacgcaaa tgggcagcca tttgtcatga gaggtattaa ccatggacat 180 gcttggtata aagacaccgc ttcaacagct attcctgcca ttgcagagca aggcgccaac 240 acgattcgta ttgttttatc agatggcggt caatgggaaa aagacgacat tgacaccatt 300 cgtgaagtca ttgagcttgc ggagcaaaat aaaatggtgg ctgtcgttga agttcatgat 360 gccacgggtc gcgattcgcg cagtgattta aatcgagccg ttgattattg gatagaaatg 420 aaagatgcgc ttatcggtaa agaagatacg gttattatta acattgcaaa cgagtggtat 480 gggagttggg atggctcagc ttgggccgat ggctatattg atgtcattcc gaagcttcgc 540 gatgccggct taacacacac cttaatggtt gatgcagcag gatgggggca atatccgcaa 600 tctattcatg attacggaca agatgtgttt aatgcagatc cgttaaaaaa tacgatgttc 660 tccatccata tgtatgagta tgctggtggt gatgctaaca ctgttagatc aaatattgat 720 agagtcatag atcaagacct tgctctcgta ataggtgaat tcggtcatag acatactgat 780 ggtgatgttg atgaagatac aatccttagt tattctgaag aaactggcac agggtggctc 840 gcttggtctt ggaaaggcaa cagtaccgaa tgggactatt tagacctttc agaagactgg 900 gctggtcaac atttaactga ttgggggaat agaattgtcc acggggccga tggcttacag 960 gaaacctcca aaccatccac cgtatttaca gatgataacg gtggtcaccc tgaaccgcca 1020 actgctacta ccttgtatga ctttgaagga agcacacaag ggtggcatgg aagcaacgtg 1080 accggtggcc cttggtccgt aacagaatgg ggtgcttcag gtaactactc tttaaaagcc 1140 gatgtaaatt taacctcaaa ttcttcacat gaactgtata gtgaacaaag tcgtaatcta 1200 cacggatact ctcagctcaa cgcaaccgtt cgccatgcca attggggaaa tcccggtaat 1260 ggcatgaatg caagacttta cgtgaaaacg ggctctgatt atacatggca tagcggtcct 1320 tttacacgta tcaatagctc caactcagga acaacgttat cttttgattt aaacaacatc 1380 gaaaatatca tcatgttagg gaaatag 1407 <210> 4 <211> 468 <212> PRT <213> Bacillus sp. <223> amino acid, linear <400> 4 Met Lys Lys Lys Leu Ser Gln Ile Tyr His Leu Ile Ile Cys Thr Leu 1 5 10 15 Ile Ile Ser Val Gly Ile Met Gly Ile Thr Thr Ser Pro Ser Ala Ala 20 25 30 Ser Thr Gly Phe Tyr Val Asp Gly Asn Thr Leu Tyr Asp Ala Asn Gly 35 40 45 Gln Pro Phe Val Met Arg Gly Ile Asn His Gly His Ala Trp Tyr Lys 50 55 60 Asp Thr Ala Ser Thr Ala Ile Pro Ala Ile Ala Glu Gln Gly Ala Asn 65 70 75 80 Thr Ile Arg Ile Val Leu Ser Asp Gly Gly Gln Trp Glu Lys Asp Asp 85 90 95 Ile Asp Thr Ile Arg Glu Val Ile Glu Leu Ala Glu Gln Asn Lys Met 100 105 110 Val Ala Val Val Glu Val His Asp Ala Thr Gly Arg Asp Ser Arg Ser 115 120 125 Asp Leu Asn Arg Ala Val Asp Tyr Trp Ile Glu Met Lys Asp Ala Leu 130 135 140 Ile Gly Lys Glu Asp Thr Val Ile Ile Asn Ile Ala Asn Glu Trp Tyr 145 150 155 160 Gly Ser Trp Asp Gly Ser Ala Trp Ala Asp Gly Tyr Ile Asp Val Ile 165 170 175 Pro Lys Leu Arg Asp Ala Gly Leu Thr His Thr Leu Met Val Asp Ala 180 185 190 Ala Gly Trp Gly Gln Tyr Pro Gln Ser Ile His Asp Tyr Gly Gln Asp 195 200 205 Val Phe Asn Ala Asp Pro Leu Lys Asn Thr Met Phe Ser Ile His Met 210 215 220 Tyr Glu Tyr Ala Gly Gly Asp Ala Asn Thr Val Arg Ser Asn Ile Asp 225 230 235 240 Arg Val Ile Asp Gln Asp Leu Ala Leu Val Ile Gly Glu Phe Gly His 245 250 255 Arg His Thr Asp Gly Asp Val Asp Glu Asp Thr Ile Leu Ser Tyr Ser 260 265 270 Glu Glu Thr Gly Thr Gly Trp Leu Ala Trp Ser Trp Lys Gly Asn Ser 275 280 285 Thr Glu Trp Asp Tyr Leu Asp Leu Ser Glu Asp Trp Ala Gly Gln His 290 295 300 Leu Thr Asp Trp Gly Asn Arg Ile Val His Gly Ala Asp Gly Leu Gln 305 310 315 320 Glu Thr Ser Lys Pro Ser Thr Val Phe Thr Asp Asp Asn Gly Gly His 325 330 335 Pro Glu Pro Pro Thr Ala Thr Thr Leu Tyr Asp Phe Glu Gly Ser Thr 340 345 350 Gln Gly Trp His Gly Ser Asn Val Thr Gly Gly Pro Trp Ser Val Thr 355 360 365 Glu Trp Gly Ala Ser Gly Asn Tyr Ser Leu Lys Ala Asp Val Asn Leu 370 375 380 Thr Ser Asn Ser Ser His Glu Leu Tyr Ser Glu Gln Ser Arg Asn Leu 385 390 395 400 His Gly Tyr Ser Gln Leu Asn Ala Thr Val Arg His Ala Asn Trp Gly 405 410 415 Asn Pro Gly Asn Gly Met Asn Ala Arg Leu Tyr Val Lys Thr Gly Ser 420 425 430 Asp Tyr Thr Trp His Ser Gly Pro Phe Thr Arg Ile Asn Ser Ser Asn 435 440 445 Ser Gly Thr Thr Leu Ser Phe Asp Leu Asn Asn Ile Glu Asn Ile Ile 450 455 460 Met leu gly lys 465 <210> 5 <211> 1029 <212> DNA <213> Bacillus sp. <223> nucleic acid, single, linear <400> 5 aattggcgca tactgtgtcg cctgtgaatc ctaatgccca gcagacaaca aaaacagtga 60 tgaactggct tgcgcacctg ccgaaccgaa cggaaaacag agtcctttcc ggagcgttcg 120 gaggttacag ccatgacaca ttttctatgg ctgaggctga tagaatccga agcgccaccg 180 ggcaatcgcc tgctatttat ggctgcgatt atgccagagg atggcttgaa acagcaaata 240 ttgaagattc aatagatgta agctgcaacg gcgatttaat gtcgtattgg aaaaatggcg 300 gaattccgca aatcagtttg cacctggcga accctgcttt tcagtcaggg cattttaaaa 360 caccgattac aaatgatcag tataaaaaca tattagattc agcaacagcg gaagggaagc 420 ggctaaatgc catgctcagc aaaattgctg acggacttca agagttggag aaccaaggtg 480 tgcctgttct gttcaggccg ctgcatgaaa tgaacggcga atggttttgg tggggactca 540 catcatataa ccaaaaggat aatgaaagaa tctctctata taaacagctc tacaagaaaa 600 tctatcatta tatgaccgac acaagaggac ttgatcattt gatttgggtt tactctcccg 660 acgccaaccg agattttaaa actgattttt acccgggcgc gtcttacgtg gatattgtcg 720 gattagatgc gtattttcaa gatgcctact cgatcaatgg atacgatcag ctaacagcgc 780 ttaataaacc atttgctttt acagaagtcg gcccgcaaac agcaaacggc agcttcgatt 840 acagcctgtt catcaatgca ataaaacaaa aatatcctaa aaccatttac tttctggcat 900 ggaatgatga atggagcgca gcagtaaaca agggtgcttc agctttatat catgacagct 960 ggacactcaa caagggagaa atatggaatg gtgattcttt aacgccaatc gttgagtgaa 1020 tccgggatc 1029 <210> 6 <211> 363 <212> PRT <213> Bacillus sp. <223> amino acid, linear <400> 6 Leu Phe Lys Lys His Thr Ile Ser Leu Leu Ile Ile Phe Leu Leu Ala 1 5 10 15 Ser Ala Val Leu Ala Lys Pro Ile Glu Ala His Thr Val Ser Pro Val 20 25 30 Asn Pro Asn Ala Gln Gln Thr Thr Lys Thr Val Met Asn Trp Leu Ala 35 40 45 His Leu Pro Asn Arg Thr Glu Asn Arg Val Leu Ser Gly Ala Phe Gly 50 55 60 Gly Tyr Ser His Asp Thr Phe Ser Met Ala Glu Ala Asp Arg Ile Arg 65 70 75 80 Ser Ala Thr Gly Gln Ser Pro Ala Ile Tyr Gly Cys Asp Tyr Ala Arg 85 90 95 Gly Trp Leu Glu Thr Ala Asn Ile Glu Asp Ser Ile Asp Val Ser Cys 100 105 110 Asn Gly Asp Leu Met Ser Tyr Trp Lys Asn Gly Gly Ile Pro Gln Ile 115 120 125 Ser Leu His Leu Ala Asn Pro Ala Phe Gln Ser Gly His Phe Lys Thr 130 135 140 Pro Ile Thr Asn Asp Gln Tyr Lys Asn Ile Leu Asp Ser Ala Thr Ala 145 150 155 160 Glu Gly Lys Arg Leu Asn Ala Met Leu Ser Lys Ile Ala Asp Gly Leu 165 170 175 Gln Glu Leu Glu Asn Gln Gly Val Pro Val Leu Phe Arg Pro Leu His 180 185 190 Glu Met Asn Gly Glu Trp Phe Trp Trp Gly Leu Thr Ser Tyr Asn Gln 195 200 205 Lys Asp Asn Glu Arg Ile Ser Leu Tyr Lys Gln Leu Tyr Lys Lys Ile 210 215 220 Tyr His Tyr Met Thr Asp Thr Arg Gly Leu Asp His Leu Ile Trp Val 225 230 235 240 Tyr Ser Pro Asp Ala Asn Arg Asp Phe Lys Thr Asp Phe Tyr Pro Gly 245 250 255 Ala Ser Tyr Val Asp Ile Val Gly Leu Asp Ala Tyr Phe Gln Asp Ala 260 265 270 Tyr Ser Ile Asn Gly Tyr Asp Gln Leu Thr Ala Leu Asn Lys Pro Phe 275 280 285 Ala Phe Thr Glu Val Gly Pro Gln Thr Ala Asn Gly Ser Phe Asp Tyr 290 295 300 Ser Leu Phe Ile Asn Ala Ile Lys Gln Lys Tyr Pro Lys Thr Ile Tyr 305 310 315 320 Phe Leu Ala Trp Asn Asp Glu Trp Ser Ala Ala Val Asn Lys Gly Ala 325 330 335 Ser Ala Leu Tyr His Asp Ser Trp Thr Leu Asn Lys Gly Glu Ile Trp 340 345 350 Asn Gly Asp Ser Leu Thr Pro Ile Val Glu * 355 360
权利要求:
Claims (8) [1" claim-type="Currently amended] Laundry detergent and / or fabric protection composition comprising laundry detergent and / or fabric protection ingredients, metase enzymes and clays. [2" claim-type="Currently amended] The laundry according to claim 1, wherein the metase is present as a pure enzyme in an amount of 0.0001% to 2%, preferably 0.0005% to 0.5%, more preferably 0.001% to 0.02% by weight of the total composition. Detergents and / or fabric protection compositions. [3" claim-type="Currently amended] The clay according to claim 1 or 2, wherein the clay is comprised in an amount of 0.1% to 50% by weight, preferably 3% to 25% by weight, more preferably 4% to 15% by weight of the total composition. Laundry Detergents and / or Fabric Protective Compositions. [4" claim-type="Currently amended] The laundry detergent and / or fabric protection composition according to any one of claims 1 to 3, wherein the clay is smectite clay, preferably montmorillonite or hectorite clay, having a cation exchange capacity of at least 50 meq / 100 g. [5" claim-type="Currently amended] The laundry detergent and / or fabric protection composition of claim 1, further comprising an extender selected from zeolite, sodium tripolyphosphate, laminated silicates, and / or mixtures thereof. [6" claim-type="Currently amended] 6. A laundry detergent and / or fabric protection composition according to any of claims 1 to 5, further comprising a cellulase. [7" claim-type="Currently amended] 7. A laundry detergent and / or fabric protection composition according to any one of the preceding claims, further comprising a cationic surfactant, preferably a surfactant comprising two long chain alkyls. [8" claim-type="Currently amended] A method of washing a fabric using a laundry detergent and / or a fabric protection composition according to any one of the preceding claims.
类似技术:
公开号 | 公开日 | 专利标题 US9005950B2|2015-04-14|Pectate lyase variants EP2285944B1|2013-03-13|Liquid detergent compositions US5443750A|1995-08-22|Detergent compositions with high activity cellulase and softening clays EP0791046B1|2000-04-05|Detergent compositions containing lipase and protease US6566114B1|2003-05-20|Mannanases US20050112749A1|2005-05-26|Endo-beta-1,4-glucanase from bacillus US8501448B2|2013-08-06|Family 44 xyloglucanases JP4851093B2|2012-01-11|Detergent composition US6734155B1|2004-05-11|Cleaning compositions comprising an oxidoreductase ES2263273T3|2006-12-01|Detergent compositions of fabrics and 7th for the care of fabrics that understand a chemical entity containing a deposition assistant with high affinity for cellulose, a tensioactive and a protease. US6147045A|2000-11-14|Detergent compositions comprising specific amylase and a specific surfactant system US6133227A|2000-10-17|Enzymatic detergent compositions DE69833197T2|2006-09-14|Alkalic xyloglucanase US20020037824A1|2002-03-28|Detergent compositions comprising a maltogenic alpha-amylase enzyme and a detergent ingredient ES2322690T3|2009-06-25|Xiloglucanasas of the family 44. US6268197B1|2001-07-31|Xyloglucan-specific alkaline xyloglucanase from bacillus EP0792342B1|2001-09-05|Use of specific lipolytic enzymes in detergent compositions CN101864406A|2010-10-20|Endo-beta-1,4-glucanase WO1995002675A1|1995-01-26|A detergent composition comprising two cellulase components WO1998008940A1|1998-03-05|A novel endoglucanase WO1997024421A2|1997-07-10|Detergent compositions comprising immobilized enzymes WO1992013053A2|1992-08-06|Detergent compositions with high activity cellulase and softening clays WO1999064573A1|1999-12-16|Novel mannanases US6197070B1|2001-03-06|Detergent compositions comprising alpha combination of α-amylases for malodor stripping ES2231859T3|2005-05-16|Detergent compositions that include improved proteases and amylases.
同族专利:
公开号 | 公开日 AT363527T|2007-06-15| WO1999009128A1|1999-02-25| WO1999009131A1|1999-02-25| WO1999009132A1|1999-02-25| BR9811187A|2000-07-25| CN1301294A|2001-06-27| EP1009796A1|2000-06-21| CN1306566A|2001-08-01| DE69835214T2|2007-06-21| JP2001515133A|2001-09-18| BR9811192A|2000-07-18| CA2300696A1|1999-02-25| JP2001515129A|2001-09-18| PT1009795E|2005-02-28| CZ2000506A3|2001-03-14| CA2299410A1|1999-02-25| AT276344T|2004-10-15| EP1036151A1|2000-09-20| AT230013T|2003-01-15| DE69837850T2|2008-01-24| BR9811196A|2000-07-25| ES2268780T3|2007-03-16| AU8065198A|1999-03-08| CA2301156A1|1999-02-25| CN1276824A|2000-12-13| CN1469919A|2004-01-21| WO1999009130A1|1999-02-25| AT332958T|2006-08-15| WO1999009127A1|1999-02-25| KR20010022908A|2001-03-26| MXPA00001567A|2001-06-01| MXPA00001616A|2001-06-01| JP4090690B2|2008-05-28| DE69826294T2|2005-11-17| AU8065398A|1999-03-08| DE69837850D1|2007-07-12| MXPA00001614A|2001-06-01| CN1276826A|2000-12-13| BR9811191A|2000-07-18| HU0003670A2|2001-05-28| MXPA00001618A|2001-06-01| AU7833398A|1999-03-08| JP2001515131A|2001-09-18| CA2301200A1|1999-02-25| BR9811186A|2000-07-25| BR9811195A|2000-07-25| MXPA00001610A|2001-06-01| JP2001515127A|2001-09-18| JP2001515128A|2001-09-18| BR9811189A|2000-07-25| AU7832798A|1999-03-08| CA2301404A1|1999-02-25| TR200000339T2|2000-07-21| AU7833498A|1999-03-08| JP2001515132A|2001-09-18| HU0003670A3|2001-06-28| EP1009794A1|2000-06-21| CA2301167A1|1999-02-25| MXPA00001617A|2001-06-01| AU7958198A|1999-03-08| JP2001515130A|2001-09-18| TR200000340T2|2000-11-21| WO1999009126A1|1999-02-25| WO1999009133A1|1999-02-25| DE69826294D1|2004-10-21| DE69810309T2|2003-10-16| CN1336953A|2002-02-20| CA2301168A1|1999-02-25| CN1276825A|2000-12-13| CN1276005A|2000-12-06| ID23442A|2000-04-20| AU8064198A|1999-03-08| WO1999009129A1|1999-02-25| EP0896998A1|1999-02-17| JP4090688B2|2008-05-28| BR9811190A|2000-07-18| DK1009795T3|2005-01-24| AU8064298A|1999-03-08| CA2301205A1|1999-02-25| JP2001515126A|2001-09-18| DE69810309D1|2003-01-30| MXPA00001613A|2001-06-01| ES2227845T3|2005-04-01| CZ2000502A3|2001-03-14| ES2185172T3|2003-04-16| DE69835214D1|2006-08-24| JP4090689B2|2008-05-28|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
法律状态:
1997-08-14|Priority to EP97870120.9 1997-08-14|Priority to EP19970870120 1998-06-10|Application filed by 데이비드 엠 모이어, 더 프록터 앤드 갬블 캄파니 2001-03-26|Publication of KR20010022893A
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 EP97870120.9|1997-08-14| EP19970870120|EP0896998A1|1997-08-14|1997-08-14|Laundry detergent compositions comprising a saccharide gum degrading enzyme| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|